A kind of microporosa haemorrhoids strain and its artificial cultivation method and application

A technology for the artificial cultivation of Microporosa haemorrhoids, which is applied in the field of Microporosa haematoporia strains and its artificial cultivation, and can solve problems such as the lack of large-scale cultivation and application

Active Publication Date: 2021-04-13
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Thrombus has a wide range of economic uses and obvious medicinal value, so more and more people develop and utilize it, but so far, there is no report on large-scale cultivation and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of microporosa haemorrhoids strain and its artificial cultivation method and application
  • A kind of microporosa haemorrhoids strain and its artificial cultivation method and application
  • A kind of microporosa haemorrhoids strain and its artificial cultivation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Identification of Pycnoporus sanguineus(L.) Murrill

[0057] Liu Yuanchao and Huang Zhiyong collected a specimen of Microporia haemorrhoids (preliminary identification) in Wuyishan, Fujian, as shown in figure 1 shown. The PDA pure culture was obtained by tissue separation method, the mycelium was collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and the DNA genome was extracted by using the Ezup column type fungal genome DNA extraction kit to obtain The DNA solution was refrigerated at -20°C for later use.

[0058] The ITS-PCR experiment of the material was carried out by the general primer ITS1 / ITS4 (ITS1:TCCGTAGGTGAACCTGCGG, ITS4:TCCTCCGCTTATTGATATGC, synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) of the fungal ribosomal intergenic region, and the amplification was carried out on a Biometra PCR instrument , the composition of the PCR reaction solution (50 μl in total) is:

[0059] TaKaRaTaq (5units / μl) 0.25μl

...

Embodiment 2

[0070] One, culture medium (by weight percentage):

[0071] 1. Tissue separation medium (comprehensive PDA):

[0072] Potato 20%, glucose 2%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 trace, and the rest is water.

[0073] 2. Purified mother seed medium (Red Bengal medium):

[0074] Peptone 0.5%, glucose 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate (MgSO4·7H2O) 0.05%, agar 2%, 1 / 3000 Bengal red solution 10%, chloramphenicol 0.01%, and the rest is water.

[0075] 3. Production medium of mother species (enriched with comprehensive PDA):

[0076] Potato 20%, glucose 2%, peptone 1%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 trace, and the rest is water.

[0077] 4. Production medium:

[0078] 98-99% sorghum, 1-2% calcium carbonate.

[0079] 5. Cultivation material:

[0080] 39% miscellaneous sawdust, 20% cottonseed hulls, 20% corncobs, 17% wheat bran, 3% corn flour, 1% lime, materia...

Embodiment 3

[0104] Example 3 Inhibition of tumor cell function

[0105] 1. Experimental method

[0106] 1. Preparation of ethyl acetate extract

[0107] Thrombus strains were fermented in solid state, and the culture medium was rice and water. After cultivating for 45 days, the rice culture medium covered with mycelia was soaked in ethyl acetate for 10 hours, then ultrasonically extracted, ultrasonically extracted for 100 min, extracted twice, and the second organic phase was combined. After the collected organic phase was suction-filtered, the liquid obtained by the suction filtration was rotary-evaporated with a rotary evaporator until there was no liquid drop, and stored at low temperature (4° C.) for future use. Simultaneous fermentation of other wild strains was performed in the same manner as a control. Paclitaxel was used as a positive control with a concentration of 0.5 mg / ml.

[0108] 2. Tumor cell culture

[0109] Tumor cell HepG2 (human liver cancer) was cultured with DMEM...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a bacterial strain and its artificial cultivation method and application, in particular to a kind of Haemoporiobacterium strain and its artificial cultivation method and application. The Pycnoporus sanguineus strain of the present invention was collected from Mount Wuyi, Fujian, and was identified as Pycnoporus sanguineus, and the original strain was obtained by tissue separation, named Pycnoporus sanguineus (Pycnoporus sanguineus) HMGIM-140415, and was preserved on July 3, 2019 In China Center for Type Culture Collection, the deposit number is CCTCC NO: M 2019514. The bacterial strain of the present invention has been artificially domesticated and cultivated, and compared with other bacterial strains of the same species, it exhibits a more intense and significant inhibitory rate on tumors and staphylococci.

Description

technical field [0001] The present invention relates to a bacterial strain and its artificial cultivation method and application, in particular to a kind of Haemoporia strain and its artificial cultivation method and application. Background technique [0002] At present, the industry of edible and medicinal fungi is developing rapidly. According to statistics from the China Edible Fungi Association, the output of edible and medicinal fungi in my country reached 37.12 million tons in 2017, an increase of 3.21% over 2016, and the output value was 272.192 billion yuan. %, more than 20 million employees, and the edible fungus industry ranks fifth in the planting industry after grain, vegetables, fruit, and oil, surpassing tea and sericulture. [0003] Today, with the vigorous development of the edible and medicinal mushroom industry, more and more rare edible and medicinal mushroom varieties have gradually entered people's field of vision. Morels etc. However, there are also a ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14C12R1/645
CPCA23V2002/00A61K36/07A23L31/00A23L33/00A61P31/04A61P35/00A01G18/00A01G18/20C12N1/145C12R2001/645A23V2200/308A23V2200/30A23V2250/208
Inventor 胡惠萍刘远超梁晓薇莫伟鹏卓丽君史钏
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap