A kind of SNP molecular marker related to the number of glandular gastric papilla in chicken and its application
A technology of molecular markers and nipples, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, DNA/RNA fragments, etc., can solve problems such as the selection of glandular and gastric papillae, increase the number of glandular and gastric papillae, reduce feeding costs, and increase production benefit effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Genome-wide association analysis
[0036] (1) Collect the venous blood of F2 generation chicken wings, and use the standard phenol-chloroform method to extract genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and finally the OD260 / 280 ratio between 1.8-2.0 was selected as qualified for subsequent tests. The concentration was uniformly diluted to 50ng / μl for genotyping.
[0037] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip manual for genotyping and quality control, mainly including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, reject call rate less than 0.97, deviation from Hardy-Weinberg balance ≤10 -6 SNP markers; BEAGLE v4.0 selects R 2 SNPs >0.5 were filled. Quality control left 435867 SNPs and 1252 samples for subsequent analysis.
[0038] (3) Genome-wide association study (GWAS) metho...
Embodiment 2
[0040] The establishment of the allele detection method of the number of glandular gastric papilla in embodiment 2
[0041] (1) Amplify a 220bp nucleotide fragment on chromosome 3 with primers for the target fragment of the SNP marker site significantly related to the number of gastric papillae. The upstream and downstream primers for sequence amplification are:
[0042] Upstream primer xian-F: ACCTCGTCTGCTGTCCATAG (SEQ ID NO.1)
[0043] Downstream primer xian-R: GCCTGTTTAATGTGCTCCCA (SEQ ID NO.2)
[0044] (2) PCR amplification:
[0045] The reagents in this example were obtained from Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangong Company.
[0046] Using the obtained C3 strain chicken genomic DNA as a template, PCR amplification was performed using primers xian-F and xian-R.
[0047] The amplification system is as follows:
[0048]
[0049] The PCR reaction procedure is as follows:
[0050]
[0051] (3) Sequence s...
Embodiment 3
[0056] Example 3 Effect Analysis of Molecular Marker SNP rs312759222 Mutation
[0057] A SNP molecular marker that improves the number of chicken glandular papillae provided by the present invention, the glandular glandular papillae number of CC and TT genotype is more, the glandular gastric papillae number of CT genotype is less, such as figure 2 As shown, therefore, individuals with CC and TT homozygous genotypes were selected during the subculture selection process, and individuals with CT heterozygous genotypes were eliminated.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


