Gene, gene fragment, corresponding dsRNA for regulating synthesis of sex pheromone of Blattella germanica and preparation method and application thereof
A technology of German cockroaches and gene fragments, applied in the field of dsRNA and its preparation, to achieve the effects of reducing content and release, good application potential, and reducing protein expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0034] Example 2 of the present invention is: the acquisition of the CYP4PC1 gene fragment of Blattella germanica and its corresponding dsRNA:
[0035] 1. Synthesis of primers
[0036] Utilize the NCBI database Primer-BLAST to design specific primers for the CYP4PC1 gene fragment, including primer pair: AGAAGATGTGCAACTCGGTGA (SEQ ID No.5) and CTCCGTTTTCTGGTCGAAGGA (SEQ ID No.6) and primer pair: TAATACGACTCACTATAGGGAGAAGATGTGCAACTCGGTGA (SEQ ID No.7) and TAATACGACTCACTATAGGGCTCCGTTTTCTGGTCGAAGGA (SEQ ID No. 8). The above primer fragments were synthesized by Qingke Biotech (Guangzhou).
[0037] 2. Obtaining the CYP4PC1 gene fragment
[0038] With the recombinant plasmid containing SEQ ID No.1 as a template, use the primers shown in SEQ ID No.5 and SEQ ID No.6 (pairing use) respectively with nucleotide sequences to carry out PCR amplification and obtain the CYP4PC1 fragment (its nucleoside The acid sequence is shown in SEQ ID No.3). The amplified CYP4PC1 gene fragment was clo...
Embodiment 3
[0045] Embodiment three of the present invention is: the application of a P450 gene regulating the synthesis of sex pheromones of German cockroaches in the control of German cockroaches:
[0046] One, the dsRNA that can specifically inhibit the P450 gene in the German cockroach injection embodiment two
[0047] Sixty female Blattella germanicas within 12 hours of eclosion were selected and randomly divided into two groups of 30 in each group. The treatment group was injected with dsCYP4PC1, and the control group was injected with the corresponding dsRNA fragment (dsMuslta) of the mouse lymphotoxin protein gene. Inject 2 μL dsRNA (6 μg) from the abdominal internode pleats with a microinjector, repeat the injection of the same dose of dsRNA on the second and fourth day to maintain the continuous inhibitory effect on the target gene, inject three times in total, and feed under normal conditions after injection .
[0048] 2. Validation of dsRNA interference effect on P450 gene ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com