Unlock instant, AI-driven research and patent intelligence for your innovation.

An indel molecular marker for identifying single-clustered inflorescences of pepper, primers and applications

A molecular marker, pepper technology, applied in the field of pepper breeding and molecular biology, can solve the problems of low selection efficiency, slow breeding progress, backwardness, etc., and achieve the effect of saving manpower and material resources, reducing workload, and shortening breeding cycle.

Active Publication Date: 2022-06-07
HUNAN AGRICULTURAL UNIV +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the means of pepper breeding are still relatively backward, and molecular assisted breeding has not been well applied, resulting in slow breeding progress and low selection efficiency.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An indel molecular marker for identifying single-clustered inflorescences of pepper, primers and applications
  • An indel molecular marker for identifying single-clustered inflorescences of pepper, primers and applications
  • An indel molecular marker for identifying single-clustered inflorescences of pepper, primers and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] In this example, an Indel molecular marker for identifying a novel single cluster inflorescence in pepper is designed based on the upstream and downstream sequences of the insertion / deletion closely linked to the novel cluster inflorescence gene in pepper. The steps of obtaining the molecular markers closely linked with the novel cluster inflorescence gene of pepper are as follows:

[0048] (1) Population construction: The F2 population CS and SY ( figure 1 ). CL74, L816 and CJ220 are all preserved in the pepper germplasm resource bank of Hunan Vegetable Research Institute and can be sold externally;

[0049] (2) Phenotypic identification: Two F2 populations, CS and SY, were planted in a glass greenhouse for conventional cultivation management. The phenotypic identification of the individual plants of the F2 population was carried out after the individual plants of the population entered the flowering stage.

[0050] (3) Mixed pool sequencing: 30 individual plants o...

Embodiment 2

[0058] Validation of tightly linked molecular markers for novel cluster inflorescence genes in pepper:

[0059] Using the molecular markers obtained in Example 1 to identify 50 cluster recessive individual plants randomly selected from the two F2 populations of CS and SY, the steps are as follows:

[0060] (1) The single plant DNA of pepper F2 population was extracted by CTAB method as a template, the DNA concentration was 30-100ng / ul, and PCR amplification was carried out using molecular markers. The forward primer sequence was CaDH-F: CGGGAGGCTATGTGACATTC, and the reverse primer sequence was CaDH -R: TCTACGTCGTCCACGTTCAA, PCR reaction system: the total volume is 20 μl, and the specific components are as follows: PCR was performed in a 20 μL reaction system consisting of 1 μl genomic DNA (30 ng / μl), 18 μl PCR-T3-Mix (TSINGKE) and forward and reverse primer (primer concentration is 10μmol) each 0.5μl;

[0061] (2) The PCR reaction was carried out on the S1000 PCR machine prod...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Indel molecular marker for identifying single-clustered inflorescences of pepper, primers and applications. Four highly homozygous inbred lines were used to construct two F2 populations (CS, SY). Chromosomal regions and candidate genes that are closely linked to pepper cluster inflorescences were obtained by population segregation analysis (BSA) and linkage mapping methods, and molecular markers were further developed based on closely linked mutations near candidate genes, using the markers for CS and SY The genotype identification of individual plants in F2 population, the coincidence rate reached 100% in CS and 94% in SY. The results of this study not only help to supplement the identification method of pepper inflorescence structure type and molecular assisted breeding, but also provide a basis for map-based cloning of pepper cluster inflorescence genes controlling this species and analysis of the molecular mechanism of cluster inflorescence formation.

Description

technical field [0001] The invention belongs to the field of pepper breeding and molecular biology, and relates to an Indel molecular marker, primer and application for identifying novel single-clustered inflorescences of pepper. Background technique [0002] Pepper (Capsicum annuum L.) is an important nightshade vegetable native to Central and South America. Because of its special taste and rich nutritional value, pepper is deeply loved by consumers. It is currently widely planted around the world. China, as one of the main producing areas, currently has more planting area than Chinese cabbage. The first vegetable crop. According to the statistics of FAO in 2017, the global production of pepper has exceeded 40 million tons, which has produced huge economic benefits. Pepper fruit is an economic product, and high yield as the main breeding goal is highly valued. The trait of pepper fruit clustering can significantly increase the number of fruits per plant, thereby greatly i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 欧立军吕俊恒陈文超于会洋戴雄泽马艳青张竹青杨博智李雪峰邹学校
Owner HUNAN AGRICULTURAL UNIV