An indel molecular marker for identifying single-clustered inflorescences of pepper, primers and applications
A molecular marker, pepper technology, applied in the field of pepper breeding and molecular biology, can solve the problems of low selection efficiency, slow breeding progress, backwardness, etc., and achieve the effect of saving manpower and material resources, reducing workload, and shortening breeding cycle.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] In this example, an Indel molecular marker for identifying a novel single cluster inflorescence in pepper is designed based on the upstream and downstream sequences of the insertion / deletion closely linked to the novel cluster inflorescence gene in pepper. The steps of obtaining the molecular markers closely linked with the novel cluster inflorescence gene of pepper are as follows:
[0048] (1) Population construction: The F2 population CS and SY ( figure 1 ). CL74, L816 and CJ220 are all preserved in the pepper germplasm resource bank of Hunan Vegetable Research Institute and can be sold externally;
[0049] (2) Phenotypic identification: Two F2 populations, CS and SY, were planted in a glass greenhouse for conventional cultivation management. The phenotypic identification of the individual plants of the F2 population was carried out after the individual plants of the population entered the flowering stage.
[0050] (3) Mixed pool sequencing: 30 individual plants o...
Embodiment 2
[0058] Validation of tightly linked molecular markers for novel cluster inflorescence genes in pepper:
[0059] Using the molecular markers obtained in Example 1 to identify 50 cluster recessive individual plants randomly selected from the two F2 populations of CS and SY, the steps are as follows:
[0060] (1) The single plant DNA of pepper F2 population was extracted by CTAB method as a template, the DNA concentration was 30-100ng / ul, and PCR amplification was carried out using molecular markers. The forward primer sequence was CaDH-F: CGGGAGGCTATGTGACATTC, and the reverse primer sequence was CaDH -R: TCTACGTCGTCCACGTTCAA, PCR reaction system: the total volume is 20 μl, and the specific components are as follows: PCR was performed in a 20 μL reaction system consisting of 1 μl genomic DNA (30 ng / μl), 18 μl PCR-T3-Mix (TSINGKE) and forward and reverse primer (primer concentration is 10μmol) each 0.5μl;
[0061] (2) The PCR reaction was carried out on the S1000 PCR machine prod...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


