Indel molecular marker for identifying novel single fasciated inflorescence of capsicum annuum L., primer and application

A molecular marker and inflorescence technology, applied in the field of pepper breeding and molecular biology, can solve the problems of low selection efficiency, slow breeding progress and backwardness, and achieve the effects of shortening the breeding cycle, saving manpower and material resources, and reducing workload.

Active Publication Date: 2019-11-22
HUNAN AGRICULTURAL UNIV +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the means of pepper breeding are still relatively backward, and molecular assisted breeding has not been well applied, resulting in slow breeding progress and low selection efficiency.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indel molecular marker for identifying novel single fasciated inflorescence of capsicum annuum L., primer and application
  • Indel molecular marker for identifying novel single fasciated inflorescence of capsicum annuum L., primer and application
  • Indel molecular marker for identifying novel single fasciated inflorescence of capsicum annuum L., primer and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] In this embodiment, an Indel molecular marker for identifying a novel single-clustered inflorescence of pepper is designed based on the upstream and downstream sequences of insertions / deletions closely linked with the new-type pepper-clustered inflorescence gene.

[0048] The steps for obtaining the above-mentioned molecular markers closely linked with the pepper novel cluster inflorescence gene are as follows:

[0049] (1) Population construction: using pepper solitary inflorescence high-generation inbred lines L816 and CJ220 as female parents, and clustered inflorescence mutant CL74 as male parent, construct F2 populations CS and SY ( figure 1 ). CL74, L816 and CJ220 are all stored in the Pepper Germplasm Resource Bank of Hunan Vegetable Research Institute and can be sold;

[0050] (2) Phenotype identification: two F2 populations, CS and SY, were planted in a glass greenhouse for conventional cultivation and management. The phenotype identification of the individua...

Embodiment 2

[0059] Validation of tightly linked molecular markers for novel cluster inflorescence genes in pepper:

[0060] Using the molecular markers obtained in Example 1 to identify 50 clustered recessive individuals randomly selected from the two F2 populations of CS and SY, the steps are as follows:

[0061] (1) Use the CTAB method to extract the DNA of a single plant of pepper F2 population as a template, the DNA concentration is 30-100ng / ul, and use molecular markers for PCR amplification. The forward primer sequence is CaDH-F: CGGGAGGCTATGTGACATTC, and the reverse primer sequence is CaDH -R: TCTACGTCGTCCACGTTCAA, PCR reaction system: the total volume is 20μl, and the specific components are as follows: PCR is carried out in a 20μL reaction system consisting of 1μl genomic DNA (30ng / μl), 18μl PCR-T3-Mix (TSINGKE) and forward and reverse primers (both primer concentrations are 10 μmol) each consisting of 0.5 μl;

[0062] (2) The PCR reaction was carried out on the S1000 PCR machin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Indel molecular marker for identifying novel single fasciated inflorescence of capsicum annuum L., a primer and application. Four parts of highly-homozygous selfing lines are utilized for constructing two F2 populations (CS,SY). A method of bulked segregant analysis (BSA) and a method of chain positioning are utilized for obtaining a chromosome region and a candidate gene which are closely linked to the fasciated inflorescence of the capsicum annuum L., and the molecular marker is further developed according to variations of nearby close linkage of the candidate gene. The marker is utilized for conducting genotype identification on the two F2 populations CS and SY, wherein the coincidence rate in the CS reaches 100%, and the coincidence rate in the SY reaches 94%. The research result helps to supply methods for identifying structural types of the inflorescence of the capsicum annuum L. and achieve molecular assisted breeding, and a foundation is provided forcontrolling map-based cloning of genes of the novel fasciated inflorescence of the capsicum annuum L. and analyzing a molecular mechanism formed by the fasciated inflorescence.

Description

technical field [0001] The invention belongs to the fields of capsicum breeding and molecular biology, and relates to an Indel molecular marker, primers and applications for identifying novel single-clustered inflorescences of capsicum. Background technique [0002] Pepper (Capsicum annuum L.) is an important vegetable of the nightshade family, native to Central and South America. Due to its special taste and rich nutritional value, pepper is deeply loved by consumers. At present, it is widely planted all over the world. As one of the main producing areas, China's planting area has surpassed that of Chinese cabbage. The first vegetable crop. According to the statistics of FAO in 2017, the world's output of pepper has exceeded 40 million tons, which has produced huge economic benefits. Pepper fruit is its economic product, and high yield as the main breeding goal has been highly valued. The clustering trait of pepper fruit can significantly increase the number of fruits per...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor欧立军吕俊恒陈文超于会洋戴雄泽马艳青张竹青杨博智李雪峰邹学校
OwnerHUNAN AGRICULTURAL UNIV