Unlock instant, AI-driven research and patent intelligence for your innovation.

SNP molecular marker related to chicken back pore density and application of SNP molecular marker

A technology of molecular markers and pores, which is applied in recombinant DNA technology, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problem of limiting pore density and achieve the effect of reducing the density of pores on the back and reducing the density of pores on the back of chickens

Active Publication Date: 2019-12-10
JIANGSU INST OF POULTRY SCI
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The pore density of chickens has been grown at the embryonic stage, but the measurement of the back pores in production is mostly carried out after slaughter, which limits the selection of pore density traits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular marker related to chicken back pore density and application of SNP molecular marker
  • SNP molecular marker related to chicken back pore density and application of SNP molecular marker
  • SNP molecular marker related to chicken back pore density and application of SNP molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Genome-wide association analysis

[0036] (1) Collect the venous blood of F2 generation chicken wings, and use the standard phenol-chloroform method to extract genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and finally the OD260 / 280 ratio between 1.8-2.0 was selected as qualified for subsequent tests. The concentration was uniformly diluted to 50ng / μl for genotyping.

[0037] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip manual for genotyping and quality control, mainly including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, reject call rate less than 0.97, deviation from Hardy-Weinberg balance ≤10 -6 SNP markers; BEAGLE v4.0 selects R 2 SNPs >0.5 were filled. Quality control left 435867 SNPs and 1252 samples for subsequent analysis.

[0038] (3) Genome-wide association study (GWAS) metho...

Embodiment 2

[0040] The establishment of the allele detection method of embodiment 2 back pore density

[0041] (1) A 205bp nucleotide fragment on chromosome 1 is amplified by primers for the target fragment of the SNP marker site significantly related to the density of the back pores. The upstream and downstream primers for sequence amplification are:

[0042] Upstream primer pore-F: AACCCATGAGTGATCTGCCA (SEQ ID NO.1)

[0043] Downstream primer pore-R: CCAGGGGTTGTCATAACTGC (SEQ ID NO.2)

[0044] (2) PCR amplification:

[0045] The reagents in this example were obtained from Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangong Company.

[0046] Using the obtained C3 chicken genomic DNA as a template, PCR amplification was performed using primers pore-F and pore-R.

[0047] The amplification system is as follows:

[0048]

[0049]

[0050] The PCR reaction procedure is as follows:

[0051]

[0052] (3) Sequence sequencing and iden...

Embodiment 3

[0057] Example 3 Effect Analysis of Molecular Marker SNP rs312355347G>A Mutation

[0058] A SNP molecular marker that reduces the chicken back pore density provided by the present invention, the back pore density of the AA genotype is less, and the pore density of the GG and GA genotypes is more, such as figure 2 shown. In the process of subculture selection, individuals with AA genotype were selected, and individuals with GG and GA genotype were eliminated.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP molecular marker related to a chicken back pore density and belongs to the field of molecular markers and genetic breeding. An SNP site of the SNP molecular marker is located at a 169981107 site of a first chromosome of an international chicken reference genome GRCg6a Primary Assembly version, and a base at the site is G or A. The invention further provides a primercombination for detecting the SNP marker and application of the primer composition. By means of the SNP molecular marker and the primer combination, an efficient and accurate molecular marker assistedbreeding method for the back pore density can be established, so that the back pore density is effectively selected, and breeding of the anti-stress chicken breeds is promoted.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, and in particular relates to a SNP molecular marker related to chicken back pore density and an application thereof. Background technique [0002] With the intensification of the global warming effect, chickens in intensive farming environments are increasingly affected by abiotic stress, especially heat stress. Because birds have no sweat glands, the regulation of body temperature is mainly through respiration, and the density of pores indirectly affects the regulation of body temperature of birds. In a high-temperature environment, fewer pores represent less feather coverage, which can improve heat stress and effectively regulate body temperature, thereby enabling adaptation to a hot and humid environment. [0003] The main purpose of breeding is to improve the production performance of livestock and poultry. However, the improvement of the production performance of livestock and pou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 沈曼曼王克华曲亮马猛卢建窦套存胡玉萍郭军王星果李永峰李尚民
Owner JIANGSU INST OF POULTRY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More