SNP molecular marker related to chicken back pore density and application of SNP molecular marker
A technology of molecular markers and pores, which is applied in recombinant DNA technology, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problem of limiting pore density and achieve the effect of reducing the density of pores on the back and reducing the density of pores on the back of chickens
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Genome-wide association analysis
[0036] (1) Collect the venous blood of F2 generation chicken wings, and use the standard phenol-chloroform method to extract genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and finally the OD260 / 280 ratio between 1.8-2.0 was selected as qualified for subsequent tests. The concentration was uniformly diluted to 50ng / μl for genotyping.
[0037] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip manual for genotyping and quality control, mainly including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, reject call rate less than 0.97, deviation from Hardy-Weinberg balance ≤10 -6 SNP markers; BEAGLE v4.0 selects R 2 SNPs >0.5 were filled. Quality control left 435867 SNPs and 1252 samples for subsequent analysis.
[0038] (3) Genome-wide association study (GWAS) metho...
Embodiment 2
[0040] The establishment of the allele detection method of embodiment 2 back pore density
[0041] (1) A 205bp nucleotide fragment on chromosome 1 is amplified by primers for the target fragment of the SNP marker site significantly related to the density of the back pores. The upstream and downstream primers for sequence amplification are:
[0042] Upstream primer pore-F: AACCCATGAGTGATCTGCCA (SEQ ID NO.1)
[0043] Downstream primer pore-R: CCAGGGGTTGTCATAACTGC (SEQ ID NO.2)
[0044] (2) PCR amplification:
[0045] The reagents in this example were obtained from Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangong Company.
[0046] Using the obtained C3 chicken genomic DNA as a template, PCR amplification was performed using primers pore-F and pore-R.
[0047] The amplification system is as follows:
[0048]
[0049]
[0050] The PCR reaction procedure is as follows:
[0051]
[0052] (3) Sequence sequencing and iden...
Embodiment 3
[0057] Example 3 Effect Analysis of Molecular Marker SNP rs312355347G>A Mutation
[0058] A SNP molecular marker that reduces the chicken back pore density provided by the present invention, the back pore density of the AA genotype is less, and the pore density of the GG and GA genotypes is more, such as figure 2 shown. In the process of subculture selection, individuals with AA genotype were selected, and individuals with GG and GA genotype were eliminated.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



