A preparation method and application of a rag1 gene-deficient animal model
A gene defect and animal model technology, applied in the field of animal genetic engineering and genetic modification, can solve problems such as the failure of recombination, the failure of T cells and B cells to mature normally, and achieve the effect of ensuring the success rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Establishment of Rag1-KO mouse model (failure case)
[0043] Rag1 gene-deficient mouse model was established by gene editing technology to destroy Exon2 of mouse Rag1 gene.
[0044] (1) Determine the knockout region
[0045] According to the selective destruction of Exon2 in the Rag1 gene domain, the designed sgRNA sequence is shown in Table 1.
[0046] Table 1 sgRNA information
[0047] sgRNA name sgRNA sequence (5'→3') S1a GTAAGGTTTCCCCTCTGAGG (SEQ No. 1) S1b CCAGTAGTTCCCAGAGAAGCCTGG (SEQ No. 2) S2a CTTGACTTCCCATCAGCATGG (SEQ No. 3) S2b AGACACTTCTGCCGCATCTGTGG (SEQ No. 4)
[0048] sgRNA transcription preparation method: use the PrimerStar Max system (Table 3), sgRNA-F and sgRNA-R as primers, and perform PCR on the correctly sequenced puc57-sgRNA plasmid (1:30 dilution) as a template, and purify the PCR product to prepare sgRNA transcription Prepare the template. Transcription of sgRNA was carried out using T7-...
Embodiment 2
[0067] Example 2: Establishment of Rag1-KO mouse model
[0068] Rag1 gene-deficient mouse model was established by knocking out Exon2 of mouse Rag1 gene by gene editing technology. C57BL / 6 mouse is a relatively mature mouse strain in research at present. C57BL / 6 mouse was used as the background mouse, and the Rag1-KO mouse model was successfully obtained.
[0069] (1) Determine the knockout region
[0070] Exon2 was completely knocked out according to the selection of the Rag1 gene structural domain, and the specific knockout sequence is shown in SEQ No.7.
[0071] Mouse Rag1 gene Exon2 sequence SEQ No.7
[0072]atggctgcctccttgccgtctaccctgagcttcagttctgcacccgatgaaattcaacacccacaaatcaaattttccgagtggaaatttaagctgtttagggtgagatcctttgaaaaggcacccgaagaagcacagaaggagaaggattcctcagaggggaaaccttacctagaacagtctccagtagttccagagaagcctggtggtcagaactcaattctgactcaacgagcactgaaactccatcctaaattttcaaagaaattccatgctgatgggaagtcaagcgacaaagcagttcaccaagccaggcttagacacttctgccgcatctgtgggaatcgtttcaagagtgacgggcacagc...
Embodiment 3
[0090] Example 3: Detection data of Rag1-KO mouse model
[0091] 1. Evaluation of immune system indicators in Rag1-KO mice
[0092] The immune system of the Rag1-KO mice obtained by the establishment of the line is not perfect, which will cause the disorder of the immune system of the mice (no mature T / B cells, compensatory increase of NK cells, etc.), which is very important for confirming the effectiveness of the strain production . The mouse immune indicators (mainly T / B / NK cells) were detected by flow cytometry to determine the immune system indicators of the mice.
[0093] The flow detection method is as follows:
[0094] Materials: Peripheral blood, spleen, and liver were collected from 8-week-old C57BL / 6 background mice and Rag1-KO homozygous mice, and placed in C-tubes.
[0095] Digestion: There is 3ml of pre-cooled enzyme digestion solution (PBS containing Ca, Mg+2%CS+10mM HEPES+30ugDNase+1.75mg collagenase D) in a C-type tube, and placed in a 37°C water bath for 3...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



