A preparation method and application of a rag1 gene-deficient animal model

A gene defect and animal model technology, applied in the field of animal genetic engineering and genetic modification, can solve problems such as the failure of recombination, the failure of T cells and B cells to mature normally, and achieve the effect of ensuring the success rate

Active Publication Date: 2021-03-30
GEMPHARMATECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Therefore, V(D)J recombination cannot proceed normally in Rag1 knockout homozygous mice, and T cells and B cells cannot mature normally.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A preparation method and application of a rag1 gene-deficient animal model
  • A preparation method and application of a rag1 gene-deficient animal model
  • A preparation method and application of a rag1 gene-deficient animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Establishment of Rag1-KO mouse model (failure case)

[0043] Rag1 gene-deficient mouse model was established by gene editing technology to destroy Exon2 of mouse Rag1 gene.

[0044] (1) Determine the knockout region

[0045] According to the selective destruction of Exon2 in the Rag1 gene domain, the designed sgRNA sequence is shown in Table 1.

[0046] Table 1 sgRNA information

[0047] sgRNA name sgRNA sequence (5'→3') S1a GTAAGGTTTCCCCTCTGAGG (SEQ No. 1) S1b CCAGTAGTTCCCAGAGAAGCCTGG (SEQ No. 2) S2a CTTGACTTCCCATCAGCATGG (SEQ No. 3) S2b AGACACTTCTGCCGCATCTGTGG (SEQ No. 4)

[0048] sgRNA transcription preparation method: use the PrimerStar Max system (Table 3), sgRNA-F and sgRNA-R as primers, and perform PCR on the correctly sequenced puc57-sgRNA plasmid (1:30 dilution) as a template, and purify the PCR product to prepare sgRNA transcription Prepare the template. Transcription of sgRNA was carried out using T7-...

Embodiment 2

[0067] Example 2: Establishment of Rag1-KO mouse model

[0068] Rag1 gene-deficient mouse model was established by knocking out Exon2 of mouse Rag1 gene by gene editing technology. C57BL / 6 mouse is a relatively mature mouse strain in research at present. C57BL / 6 mouse was used as the background mouse, and the Rag1-KO mouse model was successfully obtained.

[0069] (1) Determine the knockout region

[0070] Exon2 was completely knocked out according to the selection of the Rag1 gene structural domain, and the specific knockout sequence is shown in SEQ No.7.

[0071] Mouse Rag1 gene Exon2 sequence SEQ No.7

[0072]atggctgcctccttgccgtctaccctgagcttcagttctgcacccgatgaaattcaacacccacaaatcaaattttccgagtggaaatttaagctgtttagggtgagatcctttgaaaaggcacccgaagaagcacagaaggagaaggattcctcagaggggaaaccttacctagaacagtctccagtagttccagagaagcctggtggtcagaactcaattctgactcaacgagcactgaaactccatcctaaattttcaaagaaattccatgctgatgggaagtcaagcgacaaagcagttcaccaagccaggcttagacacttctgccgcatctgtgggaatcgtttcaagagtgacgggcacagc...

Embodiment 3

[0090] Example 3: Detection data of Rag1-KO mouse model

[0091] 1. Evaluation of immune system indicators in Rag1-KO mice

[0092] The immune system of the Rag1-KO mice obtained by the establishment of the line is not perfect, which will cause the disorder of the immune system of the mice (no mature T / B cells, compensatory increase of NK cells, etc.), which is very important for confirming the effectiveness of the strain production . The mouse immune indicators (mainly T / B / NK cells) were detected by flow cytometry to determine the immune system indicators of the mice.

[0093] The flow detection method is as follows:

[0094] Materials: Peripheral blood, spleen, and liver were collected from 8-week-old C57BL / 6 background mice and Rag1-KO homozygous mice, and placed in C-tubes.

[0095] Digestion: There is 3ml of pre-cooled enzyme digestion solution (PBS containing Ca, Mg+2%CS+10mM HEPES+30ugDNase+1.75mg collagenase D) in a C-type tube, and placed in a 37°C water bath for 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a preparation method of a Rag1 gene defect animal model, which utilizes a gene editing technology to destroy a Rag1 gene coding region of a mouse, detects the model through immune system index evaluation and pathological histological examination, and verifies that the obtained mouse model is successfully constructed. The immunodeficiency model is helpful for research in thefields of tumor transplantation, immunology, inflammation and the like.

Description

technical field [0001] The invention belongs to the field of animal genetic engineering and genetic modification, and in particular relates to a method for constructing a Rag1 gene-deficient animal model and its application. Background technique [0002] Complex biological processes often require in vivo analysis, and the study of human in vivo biology is severely constrained by ethics and technology, so animal models are increasingly required for in vivo studies of human cells, tissues, and organs. Currently, scientists have developed a variety of animal models to overcome these limitations, and they have now become important tools for in vivo studies of human cells and tissues. [0003] Immunodeficient animals refer to animals that are deficient in one or more components of the immune system due to congenital genetic mutations or artificial methods. The most representative animal is the nude mouse discovered in 1962. In recent years, with the rapid development of experime...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/90C12N9/22C12N15/113A01K67/027
CPCA01K67/0275A01K2217/075A01K2227/105A01K2267/0325A01K2267/0331A01K2267/0368C12N9/22C12N15/113C12N15/907C12N2310/20
Inventor 赵静琚存祥张明坤陶裴裴侯欢欢高翔
Owner GEMPHARMATECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products