Primer group for identifying avian adenovirus type 4 and chicken infectious anemia virus and application of primer group
A technology for chicken infectious anemia and poultry adenovirus, applied in the direction of microorganisms, recombinant DNA technology, and methods based on microorganisms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1, primer design
[0029] A large number of sequence analyzes and comparisons were carried out to obtain several primers for identifying avian adenovirus type 4 and several primers for identifying chicken infectious anemia virus. Preliminary experiments were carried out on each primer to compare the performance of sensitivity and specificity, and finally the primer pair Ⅰ and primer pair Ⅱ for identifying avian adenovirus type 4 and chicken infectious anemia virus were obtained.
[0030]The specific primer pair (primer pair I for short) used to identify avian adenovirus type 4 consists of the following two primers (5'→3'):
[0031] FadV-4F (SEQ.ID.NO.1): TTCGCCAAGTCTCAGTACAAT;
[0032] FadV-4R (SEQ.ID.NO.2): GGAGTCGTGATACAGCAGGTT;
[0033] The specific primer pair (primer pair II for short) for identifying chicken infectious anemia virus consists of the following two primers (5'→3'):
[0034] CIAV-F (SEQ.ID.NO.3): CGACATCGGAGGAGACAGA;
[0035] CIAV-R (SEQ...
Embodiment 2
[0037] Embodiment 2, double PCR reaction condition optimization
[0038] 1. Template preparation
[0039] 1. Genomic DNA of avian adenovirus type 4 was extracted to obtain sample A.
[0040] 2. Extract the DNA of chicken infectious anemia virus to obtain sample B.
[0041] 3. Mix sample A and sample B to obtain a mixed sample.
[0042] 2. Optimization of primer concentration
[0043] Take the mixed sample obtained in step 1 as a template, and use the primer combination prepared in Example 1 to perform double PCR.
[0044] Double PCR reaction system (25.0 μL): Contains 12.5 μL of 2×PCR Mix, 2.0 μL of the mixed sample obtained in step 1 (in the 2.0 μL mixed sample, the genomic DNA content of avian adenovirus type 4 is 1.0 ng, and chickens infected The DNA content of anemia virus is 1.0ng), primer pair Ⅰ and primer pair Ⅱ, finally use ddH 2 O to make up to 25.0 μL.
[0045] According to the concentration of primer pair I and primer pair II in the reaction system, set up 8 d...
Embodiment 3
[0074] Embodiment 3, specificity
[0075] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: avian adenovirus type 1-12 (FadV1-12), chicken infectious anemia virus (CIAV), chicken parvovirus (ChPV), Marek virus (MDV), infectious laryngotracheitis virus (ILTV) .
[0076] 2. Extract the total RNA of the sample to be tested and reverse transcribe it into cDNA. The samples to be tested are: avian nephritis virus (ANV), Newcastle disease virus (NDV), H9 subtype avian influenza virus (AIV-H9), and infectious bronchitis virus (IBV).
[0077] 3. Use each genomic DNA sample obtained in step 1, each cDNA sample obtained in step 2, and the mixed sample obtained in step 1 of embodiment 2 as templates, and perform double PCR using the primer combination prepared in embodiment 1.
[0078] Reaction system for double PCR (25.0 μL): 12.5 μL of 2×PCR Mix, 2.0 μL of template, primer pair I and primer pair II, and ddH 2 O to make up to 25.0 μL. In the reacti...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com