Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of flos chrysanthemi CmSVP gene

A chrysanthemum gene technology, applied in the application field of chrysanthemum CmSVP gene, to achieve the effect of delaying flowering time, elongation and growth promotion

Pending Publication Date: 2019-12-31
INNER MONGOLIA UNIV OF SCI & TECH
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the relevant functions in the flowering stage and morphogenesis of chrysanthemum have not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of flos chrysanthemi CmSVP gene
  • Application of flos chrysanthemi CmSVP gene
  • Application of flos chrysanthemi CmSVP gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0066] The methods used in the following examples have no special instructions, and all are regarded as conventional methods:

[0067] The first step: the chrysanthemum 'pink carpet' will be used as the recipient material for transgenic research, and it will be propagated aseptically through stem segments. The culture conditions are long-day sunshine (16h light / 8h dark), and the temperature is 23-25°C;

[0068] Prepare strains and plasmids: Plant binary expression vector pCAMBIA1304, pMD18T- CmSVP Plasmid, KOD high-fidelity Taq enzyme purchased, other restriction endonucleases, Agrobacterium competent.

[0069] Step two: CmSVP Gene acquisition

[0070] Designed according to the obtained transcriptome data (NCBI accession number is SRP109613) CmSVP For gene-specific primers, perform PCR amplification according to the following system: 1 μl cDNA template, 1 μl upstream primer CmSVP- F(ATGATGGTTAGGGAGAAAGTGC) and downstream primers CmSVP- R(TCAACCTGAGTATGGTAATCCTAAC) (10μm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses application of a flos chrysanthemi CmSVP gene. The application comprises the following steps of designing a specific primer of the CmSVP gene according to a CmSVP full-length sequence of obtained transcriptome data; performing PCR amplification; performing gel cutting, recycling and purification on a target strip after electrophoresis detection; connecting recovered DNA toa pEASY-Blunt vector, performing transformation to obtain an escherichia coli competence, and selecting 6 monoclonal sequencing to obtain pEASY-Blunt-CmSVP; performing gene comparison on sequences after sequencing through a Blast program of a NCBI network station, and predicting an ORF region of the flos chrysanthemi CmSVP gene and a presumed amino acid sequence by using an ORF finder; analyzing the physical and chemical properties of flos chrysanthemi CMSVP proteina by using an Expasy online analysis software; constructing system development evolutionary trees of different plant SVP proteinsby using an MEGA6.0 software; performing genetic transformation the CmSVP genes in flos chrysanthemi to culture plants to obtain a transgenic flos chrysanthemi variety obviously different from the wild type flos chrysanthemi, wherein a flowering time of the transgenic flos chrysanthemi is later than that of the wild type flos chrysanthemi, and elongation growth of a stem is superior to that of thewild type flos chrysanthemi.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, in particular to a chrysanthemum CmSVP application of genes. Background technique [0002] "Chrysanthemum chrysanthemum is the only one that can withstand the cold, and the golden millet is clearer at the dawn of dawn." As a traditional famous flower in my country, chrysanthemum has a long history and is regarded as a symbol of solitude, elegance, and pride. There are many varieties of chrysanthemums, which can be used for flower arrangements, potted plants, medicinal materials, etc., and have high ornamental and medicinal values. However, the flowering period is the most important limiting factor that affects people's pursuit of chrysanthemum appreciation in all seasons. Chrysanthemum flowering is mainly affected by temperature and light conditions. Most chrysanthemum varieties are typical short-day plants, which require a certain number of hours of short-day sunshine before they can e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/66A01H5/00A01H6/14
CPCC12N15/66C12N15/827C12N15/8261
Inventor 高耀辉马明魏光普马斌肖凤语
Owner INNER MONGOLIA UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More