Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting infection with schistosoma japonicum by using host exosomes miRNA-223-3p

An exosome, schistosomiasis technology, applied in the direction of DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of low sensitivity, insufficient specificity, lack of fast, sensitive, specific and stable of Japanese blood sucking worms It can achieve the effect of high sensitivity, reducing patient trauma, and good clinical application value.

Inactive Publication Date: 2020-02-07
SUN YAT SEN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Immunological diagnosis is not a direct detection of pathogens, with low sensitivity and insufficient specificity
[0006] Therefore, there is a lack of a rapid, sensitive, specific and stable detection method for Schistosoma japonicum

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting infection with schistosoma japonicum by using host exosomes miRNA-223-3p
  • Method for detecting infection with schistosoma japonicum by using host exosomes miRNA-223-3p
  • Method for detecting infection with schistosoma japonicum by using host exosomes miRNA-223-3p

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 A diagnostic kit for Schistosoma japonicum infection

[0052] 1. Composition

[0053] Amplification primers for serum exosome miR-223-3p, internal reference gene U6 amplification primers and q-PCR reagents;

[0054] Among them, the upstream primer nucleotide of serum exosomal miR-223-3p is shown in SEQ ID NO: 2 (TGTCAGTTTGTCAAATACCCCA), and the downstream primer is provided in the commercially available microRNA quantitative (qRT-PCR) (tailing method) kit Universal primers;

[0055] The nucleotide sequence of the internal reference gene U6 amplification primer is shown in SEQ ID NO: 3-4,

[0056] SEQ ID NO: 3: CTCGCTTCGGCAGCACA;

[0057] SEQ ID NO: 4: AACGCTTCACGAATTTGCGT;

[0058] The reagents for q-PCR are Premix Ex Taq TM , ROX Dye (50×) and ddH 2 O.

[0059] 2. How to use

[0060] 1. Extract exosomes from serum samples to be tested

[0061] Use a commercially available serum exosome extraction kit.

[0062] 2. Extract total exosome RNA from the...

Embodiment 2

[0082] Embodiment 2 detection sensitivity effect analysis

[0083] 1. Experimental method

[0084] The kit in Example 1 was used to detect serum exosomal miR-223-3p from healthy people from schistosomiasis-endemic areas and schistosomiasis-infected groups.

[0085] 2. Experimental results

[0086] The expression of exosomal miR-223-3p in the schistosome-infected population was higher than that in the healthy population, which was more than 2 times higher.

Embodiment 3

[0087] Embodiment 3 mouse model experiment verification sensitivity

[0088] 1. Experimental method

[0089] The schistosomiasis-infected mouse model was routinely constructed, and the sera of mice in the uninfected control group and the infected group were collected, and exosomes were extracted. The kit of claim 2 is used to detect serum exosomal miR-223-3p of uninfected control group and infected group mice.

[0090] 2. Experimental results

[0091] The serum exosomal miR-223-3p expression level of mice in the infected group was higher than that in the uninfected control group, which was more than 2 times higher.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting infection with schistosoma japonicum by using host exosomes. The nucleotide sequence of a serum exosome miR-223-3p is shown as SEQID NO:1, and the methodfor detecting infection with schistosoma japonicum is established according to a primer of which the nucleotide sequence is shown as SEQID NO:2. In accordance with the detection method of the schistosoma japonicum, the method is quick, acute, excellent and stable in detection. According to the method, the serum of patients is directly extracted, the wound parts of the patients can be alleviated,and the wound parts are small. A q-PCR detection method is used, so that the sensitivity is high, and the q-PCR detection method is high in sensitivity. An exosome extraction kit being mature exists,and besides, q-PCR detection is a common technique for laboratories, so that the method is simple relatively. Therefore, the method is worth of promotion, and has a good clinical application value.

Description

technical field [0001] The invention relates to the technical field of molecular detection of parasites, and more specifically, to the detection of Schistosoma japonicum infection by host exosome miRNA-223-3p. Background technique [0002] Schistosomiasis is a chronic parasitic disease caused by Schistosoma schistosomiasis. It is one of the zoonotic parasitic diseases and public health problems that seriously endanger society and human beings. The main functional impact of schistosomiasis on the human body is schistosomiasis liver disease, and the main pathogenic factor of schistosomiasis liver disease is granuloma and fibrosis caused by eggs. [0003] Exosomes (exosomes) are secreted by living cells, with a diameter of 30-150 nm and a mass concentration of 1.13-1.21 g / ml, carrying abundant subcellular bilayer membranous secretory vesicles related to their functions and source cells. As a newly discovered intercellular communication pathway, exosomes can selectively encapsu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/158C12Q2600/178
Inventor 吴忠道王立富孙希高江梅余子龙
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com