Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

NtOEP1 gene influencing tobacco pigment content and application thereof

A pigment content and gene technology, applied in the field of tobacco genetic engineering, can solve problems such as green and miscellaneous gas in tobacco leaves

Active Publication Date: 2020-03-06
ZHENGZHOU TOBACCO RES INST OF CNTC
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Generally speaking, fully degraded chlorophyll is more beneficial to the improvement of tobacco leaf quality, but if it cannot be degraded completely, chlorophyll will become an unfavorable chemical component in dry tobacco leaves, and then the tobacco leaves will have obvious green odor.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NtOEP1 gene influencing tobacco pigment content and application thereof
  • NtOEP1 gene influencing tobacco pigment content and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] This embodiment mainly affects the tobacco pigment content NtOEP1 The process of gene acquisition is briefly introduced as follows.

[0052] (1) Tobacco RNA extraction and cDNA synthesis

[0053] (1) Extraction of total RNA

[0054] Take the young leaves of Tobacco K326 grown for about 3 weeks as samples, which are fully ground into powder by liquid nitrogen;

[0055] Take about 100 mg of powdered material and place it in a 1.5 ml centrifuge tube containing 1.0 ml of TRIZOL reagent, then add 200 μl of chloroform, shake and mix, centrifuge, and carefully transfer the upper aqueous phase to another centrifuge tube;

[0056] Add 500 μl of isopropanol, precipitate and centrifuge to separate the RNA, then wash with 75% alcohol, dry at room temperature, add an appropriate volume of RNase free water to fully dissolve;

[0057] Finally, the extracted total RNA was treated with DNase I for subsequent cDNA preparation. When DNase I was digested, the 10 μL reaction system was r...

Embodiment 2

[0094] Utilize the obtained in embodiment 1 to influence tobacco pigment content NtOEP1 gene, the inventor further constructed the gene silencing VIGS interference vector TRV2- NtOEP1 , the relevant construction process is briefly introduced as follows.

[0095] (1) Obtaining the target fragment

[0096] choose NTOEP1A relatively specific nucleic acid fragment in the gene (nucleotide sequence 153-522 of SEQ ID NO.1 in the sequence table) is the guide sequence of VIGS. Primers are designed and PCR amplification is performed using the cDNA obtained in Implementation 1 as a template. Obtain the target gene fragment.

[0097] NtOEP1 When constructing the gene silencing vector, the primer sequences used for PCR amplification are designed as follows:

[0098] NtOEP1 -VI-F: 5'- TCGACGACAAGACCCTGCAG GCAAACTGAACTCAAGGACT-3',

[0099] NtOEP1 -VI-R: 5'- TGAGGAGAAGAGCCCTGCAG AATCTCATCAAGGGTGTAGG-3';

[0100] Among the above sequences, the "TCGACGACAAGACCCTGCAG" partial seque...

Embodiment 3

[0111] On the basis of Example 2, the inventors further utilized the Agrobacterium-mediated transgenic system to screen and obtain NtOEP1 Gene-silenced transgenic plants, combined with plant phenotypes for NtOEP1 Gene function was further analyzed. The specific process is briefly introduced as follows.

[0112] (1) Transform Agrobacterium and prepare infection solution

[0113] The TRV2- prepared in embodiment 2- NtOEP1 After transforming GV3301 Agrobacterium competent cells with the recombinant vector, spread LB plates (containing 50 mg / L kanamycin and 50 mg / L rifampicin), incubate in the dark at 28°C for 2-3 days, and pick single colonies. and colony PCR was used to screen for carrying NtOEP1 Agrobacterium monoclonal gene fragments;

[0114] As controls, TRV1, TRV2-LIC, and TRV2-PDS were also transformed with Agrobacterium.

[0115] Respectively will contain TRV1, TRV2-LIC, TRV2- NtOEP1 , TRV2-PDS single colonies of Agrobacterium were inoculated into 5 ml LB medium (c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of tobacco gene engineering, and particularly relates to an NtOEP1 gene influencing tobacco pigment content and application thereof. The gene comprises 999bp bases, 153-522 nucleotides are specific core fragments, and the base sequence of the nucleotides is shown as SEQ ID NO.1; 332 amino acids are encoded, and the amino acid sequence is shown as SEQ ID NO. 2. According to the application, by cloning and analyzing the tobacco NtOEP1 gene, the gene has important application in regulation and control of a tobacco pigment synthesis route and is highlyrelated to the content of pigment substances in plant leaves. Furthermore, through a virus-mediated gene silencing technology, the inventor finds that after the NtOEP1 gene is silenced, the content of pigment substances in a new transgenic plant is obviously reduced. By means of the characteristic, a new strategy and path can be provided for tobacco genetic engineering breeding or cultivation ofother plant new varieties.

Description

technical field [0001] The invention belongs to the technical field of tobacco genetic engineering, and in particular relates to a method for affecting tobacco pigment content. NtOEP1 Patent applications for genes and their applications. Background technique [0002] Tobacco is an economic crop for leaves. Its cultivation technology is different from other field crops. It not only requires a certain amount of tobacco leaf yield, but also pays more attention to the quality of tobacco leaves. The quality of tobacco leaves determines the availability of tobacco leaves, and directly affects the color, aroma, taste and commodity value of finished cigarettes. It is also related to the economic benefits of tobacco farmers and is the life and starting point of the tobacco industry. [0003] Pigment substances are an important class of compounds in the growth process of tobacco, mainly including chlorophyll and carotenoids. Chlorophyll will degrade and disappear in a large amount d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/12A01H6/82
CPCC07K14/415C12N15/8218C12N15/825
Inventor 徐国云刘萍萍周会娜郑庆霞张慧翟妞陈千思金立锋
Owner ZHENGZHOU TOBACCO RES INST OF CNTC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products