NtOEP1 gene influencing tobacco pigment content and application thereof
A pigment content and gene technology, applied in the field of tobacco genetic engineering, can solve problems such as green and miscellaneous gas in tobacco leaves
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] This embodiment mainly affects the tobacco pigment content NtOEP1 The process of gene acquisition is briefly introduced as follows.
[0052] (1) Tobacco RNA extraction and cDNA synthesis
[0053] (1) Extraction of total RNA
[0054] Take the young leaves of Tobacco K326 grown for about 3 weeks as samples, which are fully ground into powder by liquid nitrogen;
[0055] Take about 100 mg of powdered material and place it in a 1.5 ml centrifuge tube containing 1.0 ml of TRIZOL reagent, then add 200 μl of chloroform, shake and mix, centrifuge, and carefully transfer the upper aqueous phase to another centrifuge tube;
[0056] Add 500 μl of isopropanol, precipitate and centrifuge to separate the RNA, then wash with 75% alcohol, dry at room temperature, add an appropriate volume of RNase free water to fully dissolve;
[0057] Finally, the extracted total RNA was treated with DNase I for subsequent cDNA preparation. When DNase I was digested, the 10 μL reaction system was r...
Embodiment 2
[0094] Utilize the obtained in embodiment 1 to influence tobacco pigment content NtOEP1 gene, the inventor further constructed the gene silencing VIGS interference vector TRV2- NtOEP1 , the relevant construction process is briefly introduced as follows.
[0095] (1) Obtaining the target fragment
[0096] choose NTOEP1A relatively specific nucleic acid fragment in the gene (nucleotide sequence 153-522 of SEQ ID NO.1 in the sequence table) is the guide sequence of VIGS. Primers are designed and PCR amplification is performed using the cDNA obtained in Implementation 1 as a template. Obtain the target gene fragment.
[0097] NtOEP1 When constructing the gene silencing vector, the primer sequences used for PCR amplification are designed as follows:
[0098] NtOEP1 -VI-F: 5'- TCGACGACAAGACCCTGCAG GCAAACTGAACTCAAGGACT-3',
[0099] NtOEP1 -VI-R: 5'- TGAGGAGAAGAGCCCTGCAG AATCTCATCAAGGGTGTAGG-3';
[0100] Among the above sequences, the "TCGACGACAAGACCCTGCAG" partial seque...
Embodiment 3
[0111] On the basis of Example 2, the inventors further utilized the Agrobacterium-mediated transgenic system to screen and obtain NtOEP1 Gene-silenced transgenic plants, combined with plant phenotypes for NtOEP1 Gene function was further analyzed. The specific process is briefly introduced as follows.
[0112] (1) Transform Agrobacterium and prepare infection solution
[0113] The TRV2- prepared in embodiment 2- NtOEP1 After transforming GV3301 Agrobacterium competent cells with the recombinant vector, spread LB plates (containing 50 mg / L kanamycin and 50 mg / L rifampicin), incubate in the dark at 28°C for 2-3 days, and pick single colonies. and colony PCR was used to screen for carrying NtOEP1 Agrobacterium monoclonal gene fragments;
[0114] As controls, TRV1, TRV2-LIC, and TRV2-PDS were also transformed with Agrobacterium.
[0115] Respectively will contain TRV1, TRV2-LIC, TRV2- NtOEP1 , TRV2-PDS single colonies of Agrobacterium were inoculated into 5 ml LB medium (c...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com