Anti-trichothecenes self-protection gene mfs1 of A553 from Rhizoctonia var. and its application
A technology of trichothecenes and dewy paint spots, which can be applied in the field of genetic engineering and can solve problems such as not
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Obtaining the mfs1 sequence of anti-trichothecene self-protection gene mfs1 of Myrothecium roridum A553
[0023] Amplification of gene mfs1: inoculate endophytic fungus Myrothecium roridum A553 on YPD medium plate, culture at 37°C for 72 hours, pick fresh mycelium, and use fungal RNA extraction kit to extract RNA , and then use the All-in-one RT Master Kit to reverse transcribe to obtain cDNA. According to the transcriptome sequencing results, the anti-trichothecene self-protection gene mfs1 sequence was predicted, and the upstream and downstream primers msf1-F: 5'-ATGTTTATCGCCGCCCGTGT-3' and mfs1-R: 5'-TTAATCAAGAGGCCCACCCGT-3' were designed to generate cDNA library For template amplification, the PCR product ( figure 1). The recovered product was purified and cloned by TA using the pEASY-T1 kit, transformed into Escherichia coli DH5α competent cells, spread on the ampicillin resistance plate to select positive clones, and used the universal primer M13-F (5...
Embodiment 2
[0024] Example 2 Functional verification of anti-trichothecene self-protection gene mfs1
[0025] The gene mfs1 was inserted into the yeast vector YEp352-TEF1-CYC1 by homologous recombination (YEp352-TEF1-CYC1 is an early constructed plasmid, which carries a constitutive promoter TEF1 and a terminator CYC1. For the vector map of YEp352-TEF1-CYC1, see figure 2 A, known products in the prior art: Xiaodan Ouyang, Yaping Cha, Wen Li, Chaoyi Zhu, Muzi Zhu, Shuang Li, Min Zhuo, Shaobin Huang and Jianjun Li. Stepwise engineering of Saccharomyces cerevisiae to produce(+)-valencene and its related sequiterpenes, RSC Adv., 2019, 9, 30171, DOI: 10.1039 / c9ra05558d). First design the upstream and downstream primers msf1-U:5'- for the amplification of gene mfs1 (SEQ ID NO.1) CAATCTAATCTAAGTCTAGA ATGTTTATCGCCGCCCGTGT-3';msf1-D:5'- TGCGGCCCGTCGAC TTAATCAAGAGGCCCACCCGT-3' (the underlined sequence is the fragment of the homology arm), using the cDNA library in Example 1 as a template, the ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com