Application of anti-gliotoxin self-protection gene GliK in assisting host cells in resisting gliotoxin
A technology of gliotoxin and gene protection, applied in the field of genetic engineering, can solve problems such as redox reaction imbalance, induction of cell apoptosis, and reduction of immune activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Obtaining the self-protection gene sequence of the deep-sea fungus Geosmithiapallida FS140 against gliotoxin
[0021] Amplification of the gene GliK: Inoculate the deep-sea fungus Geosmithiapallida FS140 on a YPD medium plate, culture at 37°C for 72 hours, pick fresh mycelium, use the fungal RNA extraction kit to extract RNA, and then use the All-in-oneRTMaster Kit to reverse The cDNA was recorded. According to the results of transcriptome sequencing, the sequence of the anti-trichothecene self-protection gene GliK was predicted, and specific primers were designed upstream and downstream of it. The primer sequence was GliK-F:5'-ATGACCATACAACTCCCTCACAC-3'; GliK-R:5' -AGCGGAGGGCTGGGCGTAGC-3', using the cDNA library as template amplification to obtain PCR product ( figure 2). The product was recovered and cloned by TA with pEASY-T1 kit, transformed into Escherichia coli competent cells, spread on the ampicillin resistance plate to screen out positive clones, a...
Embodiment 2
[0022] Example 2 Functional verification of anti-gliotoxin self-protection gene GliK
[0023] The gene GliK was inserted into the yeast vector YEp352-TEF1-CYC1 by homologous recombination (YEp352-TEF1-CYC1 is an early constructed plasmid, carrying a constitutive promoter TEF1 and a terminator CYC1, see the vector map image 3 A, known products in the prior art: Xiaodan Ouyang, Yaping Cha, Wen Li, Chaoyi Zhu, Muzi Zhu, ShuangLi, Min Zhuo, Shaobin Huang and Jianjun Li. Stepwise engineering of Saccharomyces cerevisiae to produce(+)-valencene and its related sequiterpenes, RSC Adv., 2019, 9, 30171, DOI: 10.1039 / c9ra05558d). First design the upstream and downstream primers YEp352-GliK-F and YEp352-GliK-R for the amplification of gene GliK (SEQ ID NO.1), the primer sequence of which is YEp352-GliK-F:5'- AGCAATCTAATCTAAGTCTAGA ATGACCATACAACTCCCTCACAC-3'; YEp352-GliK-R:5'- TTACATGATGCGGCCCGTCGAC AGCGGAGGGCTGGGCGTAGC-3' (the underlined sequence is the homology arm fragment), the cD...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


