Oxidoreductase GliT and application thereof in resisting mycotoxins

A technology of mycotoxins and reductases, applied in the field of genetic engineering, can solve the problems of unclear harm to human body, animals and plants, etc.

Active Publication Date: 2021-04-09
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Dicerandrol C and Eupenifeldin toxins are fungal secondary metabolites isolated from deep-sea fungi Phomopsis sp.FS479 and Phomopsis tersa FS441 by our research group. They have good anti-tumor activity, but their harm to humans, animals and plants is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oxidoreductase GliT and application thereof in resisting mycotoxins
  • Oxidoreductase GliT and application thereof in resisting mycotoxins
  • Oxidoreductase GliT and application thereof in resisting mycotoxins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1 Obtaining of novel oxidoreductase GliT gene sequence

[0028] Amplification of the gene GliT: inoculate the deep-sea fungus Geosmithia pallida FS140 on the YPD medium plate, culture at 37°C for 72 hours, pick fresh mycelium, use the fungal RNA extraction kit to extract RNA, and then use the All-in-one RTMaster cDNA was obtained by reverse transcription with Kit. According to the transcriptome sequencing results, the GliT sequence of the gene encoding oxidoreductase was predicted, and the upstream and downstream primers GliT-F and GliT-R were designed. The primer sequences were GliT-F: 5'-ATGTCCATCGGAAAACTTCTCGC-3'; -3', using the cDNA library as template amplification to obtain the PCR product ( figure 1 ). The product was recovered and cloned by TA with pEASY-T1 kit, transformed into Escherichia coli competent cells, spread on the ampicillin resistance plate to screen out positive clones, and used universal primers M13-F (5'-GTAAAACGACGGCCAGT-3') and M1...

Embodiment 2

[0029] Example 2 Functional verification of novel oxidoreductase GliT

[0030] The new oxidoreductase gene GliT was inserted into the yeast vector YEp352-TEF1-CYC1 by homologous recombination (YEp352-TEF1-CYC1 is an early constructed plasmid, carrying a constitutive promoter TEF1 and a terminator CYC1, see the vector map image 3 A, known products in the prior art: Xiaodan Ouyang, Yaping Cha, Wen Li, Chaoyi Zhu, Muzi Zhu, Shuang Li, Min Zhuo, Shaobin Huang and Jianjun Li. Stepwise engineering of Saccharomyces cerevisiae to produce(+)-valencene and its related sequiterpenes, RSC Adv., 2019, 9, 30171, DOI: 10.1039 / c9ra05558d). First design the upstream and downstream primers YEp352-GliT-F and YEp352-GliT-R for the amplification of gene GliT (SEQ ID NO.1), and the primer sequence is YEp352-GliT-F:5'- GCAATCTAATCTAAGTCTAGA ATGTCCATCGGAAAACTTCTCGC-3'; YEp352-GliT-R:5'- TACATGATGCGGCCCGTCGAC CTATGGCTCCCAATCAATCCCAAAT-3' (the underlined sequence is the homology arm fragment), usi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses oxidoreductase GliT and application thereof in resisting mycotoxins. The amino acid sequence of the oxidoreductase GliT is shown as SEQ ID NO. 2. In view of the fact that no research on resistance of deep sea fungus G.pallida FS140 to various mycotoxins exists at present, the gene sequence of the oxidoreductase GliT is obtained from a cDNA library of the deep sea fungus FS140 and is successfully introduced into saccharomyces cerevisiae S.cerevisiae BJ5464 for antitoxic function verification, so that a molecular biology foundation is laid for improving the later capacity of the saccharomyces cerevisiae to resist gliotoxin and derivatives thereof, trichothecene toxins, Eupeiflin and dicererol C toxins, improving the heterologous expression level of related mycotoxins and analyzing the action mechanism of the related mycotoxins. In addition, the novel oxidoreductase GliT is further separated and purified, whether the oxidoreductase GliT has a degradation effect on the related mycotoxins is determined, and a new idea is provided for developing economic and feasible toxicity reducing reagents, mycotoxins prevention and control additives and the like.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to an oxidoreductase GliT of deep-sea fungus G. pallida and its application in resisting mycotoxins. Background technique [0002] Mycotoxins are a class of secondary metabolites produced by toxin-producing fungi during the growth process, mainly including aflatoxins, deoxynivalenol (vomitoxin), zearalenone, fumonisins and ochratoxins Wait. How to safely and rationally utilize food crops contaminated by toxins and maintain the quality and safety of national food is an urgent problem to be solved. In particular, trichothecenes, which are considered to be the most dangerous naturally occurring food pollutants, have become an international research hotspot. Trichothecenes are a general term for a large class of toxic substances with similar chemical structures produced by Fusarium fungi. Its basic structure is a tetracyclic sesquiterpene. According to different substitu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12N15/81C12N15/80C12N1/19C12N1/15C12R1/865C12R1/645
CPCC12N9/0004C12N15/81C12N15/80
Inventor李赛妮章卫民刘昭明刘洪新陈玉婵徐诗航
OwnerGUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY