Application of gene gnatb as selection marker gene in resistance selection
A technology for screening marker genes and genes, applied in the field of genetic engineering, can solve the problem of no cycloheximide resistance gene, hindering the transformation and utilization of highly active cycloheximide analogues, and no deep-sea fungal secondary metabolite organisms Synthetic gene screening markers and other issues to achieve the effect of improving the level of heterologous expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1 Acquisition of the novel screening marker GNATB gene sequence for resistance to cycloheximide
[0024] Amplification of the gene GNATB: inoculate the deep-sea fungus G.pallida FS140 on the YPD medium plate, culture at 37°C for 72 hours, pick fresh mycelium, use the fungal RNA extraction kit to extract RNA, and then use All-in-one cDNA was obtained by reverse transcription with RT MasterKit. According to the results of transcriptome sequencing, the gene sequence encoding acetyltransferase GNATB was predicted, and the upstream and downstream primers YEp352-GNATB-F and YEp352-GNATB-R were designed, and the primer sequence was YEp352-GNATB-F:5'- TAGCAATCT AATCTAAGTCTAGA ATGTCCTACCAGTCTACAATCTA-3'; YEp352-GNATB-R:5'- TACATGATGCGGCCCGT CGAC CTACACTATATCCTTATCGCAACCCA-3 (the underlined sequence is a homology arm fragment), amplified with the cDNA library as a template to obtain the PCR product ( figure 1 ). The product was recovered and cloned by TA with pEAS...
Embodiment 2
[0025] Example 2 Functional verification of the novel screening marker GNATB for resistance to cycloheximide
[0026] The GNATB gene was inserted into the yeast vector YEp352-TEF1-CYC1 by homologous recombination (YEp352-TEF1-CYC1 is an early constructed plasmid, carrying a constitutive promoter TEF1 and a terminator CYC1, see the vector map image 3 A, known products in the prior art: Xiaodan Ouyang, Yaping Cha, Wen Li, Chaoyi Zhu, Muzi Zhu, Shuang Li, Min Zhuo, Shaobin Huang and Jianjun Li. Stepwise engineering of Saccharomycescerevisiae to produce(+)-valencene and its related sequiterpenes, RSC Adv., 2019, 9, 30171, DOI: 10.1039 / c9ra05558d). First design the upstream and downstream primers YEp352-GNATB-F and YEp352-GNATB-R for gene GNATB (SEQ ID NO.1) amplification, and its primer sequence is YEp352-GNATB-F:5'- TAGCAATCTAATCTAAGTCTAGA ATGTCCTACCAGTCTACAATCTA-3'; YEp352-GNATB-R:5'- TACATGATGCGGCCCGTCGAC CTACACTATATCCTTATCGCAACCCA-3' (the underlined sequence is the fragmen...
PUM
| Property | Measurement | Unit |
|---|---|---|
| tolerance concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



