Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Application of gene gnatb as selection marker gene in resistance selection

A technology for screening marker genes and genes, applied in the field of genetic engineering, can solve the problem of no cycloheximide resistance gene, hindering the transformation and utilization of highly active cycloheximide analogues, and no deep-sea fungal secondary metabolite organisms Synthetic gene screening markers and other issues to achieve the effect of improving the level of heterologous expression

Active Publication Date: 2022-05-17
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, because the biosynthesis research of cycloheximide is a blank, this has greatly hindered the further transformation and utilization of highly active cycloheximide analogs by combinatorial biosynthesis
At present, there is no report on the resistance gene of cycloheximide, and there is no related research on the biosynthesis gene of secondary metabolites of deep-sea fungi as a screening marker.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene gnatb as selection marker gene in resistance selection
  • Application of gene gnatb as selection marker gene in resistance selection
  • Application of gene gnatb as selection marker gene in resistance selection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Acquisition of the novel screening marker GNATB gene sequence for resistance to cycloheximide

[0024] Amplification of the gene GNATB: inoculate the deep-sea fungus G.pallida FS140 on the YPD medium plate, culture at 37°C for 72 hours, pick fresh mycelium, use the fungal RNA extraction kit to extract RNA, and then use All-in-one cDNA was obtained by reverse transcription with RT MasterKit. According to the results of transcriptome sequencing, the gene sequence encoding acetyltransferase GNATB was predicted, and the upstream and downstream primers YEp352-GNATB-F and YEp352-GNATB-R were designed, and the primer sequence was YEp352-GNATB-F:5'- TAGCAATCT AATCTAAGTCTAGA ATGTCCTACCAGTCTACAATCTA-3'; YEp352-GNATB-R:5'- TACATGATGCGGCCCGT CGAC CTACACTATATCCTTATCGCAACCCA-3 (the underlined sequence is a homology arm fragment), amplified with the cDNA library as a template to obtain the PCR product ( figure 1 ). The product was recovered and cloned by TA with pEAS...

Embodiment 2

[0025] Example 2 Functional verification of the novel screening marker GNATB for resistance to cycloheximide

[0026] The GNATB gene was inserted into the yeast vector YEp352-TEF1-CYC1 by homologous recombination (YEp352-TEF1-CYC1 is an early constructed plasmid, carrying a constitutive promoter TEF1 and a terminator CYC1, see the vector map image 3 A, known products in the prior art: Xiaodan Ouyang, Yaping Cha, Wen Li, Chaoyi Zhu, Muzi Zhu, Shuang Li, Min Zhuo, Shaobin Huang and Jianjun Li. Stepwise engineering of Saccharomycescerevisiae to produce(+)-valencene and its related sequiterpenes, RSC Adv., 2019, 9, 30171, DOI: 10.1039 / c9ra05558d). First design the upstream and downstream primers YEp352-GNATB-F and YEp352-GNATB-R for gene GNATB (SEQ ID NO.1) amplification, and its primer sequence is YEp352-GNATB-F:5'- TAGCAATCTAATCTAAGTCTAGA ATGTCCTACCAGTCTACAATCTA-3'; YEp352-GNATB-R:5'- TACATGATGCGGCCCGTCGAC CTACACTATATCCTTATCGCAACCCA-3' (the underlined sequence is the fragmen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
tolerance concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses the application of the gene GNATB as a screening marker gene in resistance screening and its application. The nucleotide sequence of the gene GNATB is shown in SEQ ID NO.1. The new screening marker gene GNATB of the present invention can efficiently assist Saccharomyces cerevisiae to resist cycloheximide, thereby laying the foundation for the reconstruction of the biosynthetic pathway of cycloheximide in Saccharomyces cerevisiae and the analysis of the mechanism of action of the screening marker gene GNATB and cycloheximide Improving the heterologous expression level of cycloheximide and obtaining a new type of cycloheximide lays the foundation for molecular biology. In addition, the acetyltransferase gene GNATB can be developed into a high-efficiency expression and high-resistance selection marker gene, which can be used to screen and maintain eukaryotic cells successfully transfected with the cycloheximide resistance gene for molecular biology and microbiology and medicine and other fields.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to the application of gene GNATB as a screening marker gene in resistance screening. Background technique [0002] The screening marker gene can make the transformant obtain new genetic characteristics that it does not have; it is the basic element necessary for the genetic transformation vector; it is a special marker gene that uses a specific selection medium to screen the transformant. Resistance screening is a type of screening method in which resistance genes are transferred into recipient bacteria to allow them to grow under a certain drug concentration to express drug resistance. Commonly used resistance selection marker genes are divided into antibiotic resistance genes and herbicide resistance genes. The inhibitory effect of antibiotics on cell growth mainly lies in affecting the formation of cell wall and the function of cell membrane, and inhibiting the bio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N15/10C12N15/81C12N15/66C12R1/865
CPCC12N9/1029C12N15/1096C12N15/81C12Q2521/107C12Q2531/113Y02A50/30
Inventor 李赛妮章卫民刘洪新刘昭明陈玉婵张维阳刘珊
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com