Unlock instant, AI-driven research and patent intelligence for your innovation.

Monascus phy gene and application thereof in increasing yield of yellow pigment

A technology of Monascus and yellow pigment, which is applied in the field of phy gene to improve the production of yellow pigment by fermentation of Monascus, and can solve the problems of high cost and low yield.

Active Publication Date: 2020-03-31
TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, yellow pigments mainly include artificial synthesis, plant extraction and redox red yeast pigments, with low yield and high cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monascus phy gene and application thereof in increasing yield of yellow pigment
  • Monascus phy gene and application thereof in increasing yield of yellow pigment
  • Monascus phy gene and application thereof in increasing yield of yellow pigment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] Below in conjunction with embodiment, the present invention is further described; Following embodiment is illustrative, not limiting, can not limit protection scope of the present invention with following embodiment. Monascus cultivation mentioned in the examples, DNA extraction, PCR amplification, digestion, connection, transformation, identification of positive clones, red yeast rice solid-state fermentation and other processes, if no special instructions, all adopt conventional methods in this field It can be realized, and will not be repeated as a parallel method described in the present invention.

[0020] (1) Using the CTAB method (Shao Yanchun, Li Li, Yang Sha, Zhao Ying, Wang Xiaohong, & Chen Fusheng, 2009) to extract Monascus genomic DNA

[0021] (2) Use the primer sh-F of the upstream homology arm of the gene phy: GGGGTACCTTCATCTTCTCGGTTTA, sh-R: GCTCTAGAGGGCGTATGCTAGTATCT to amplify 968 bp of the sequence of the upstream homology arm of the phy gene, and use ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a monascus phy gene and application thereof in increasing the yield of yellow pigment. The monascus phy gene disclosed by the invention plays an important role in increasing the yield of the yellow pigment fermented by monascus, the nucleotide sequence of the monascus phy gene is shown as SEQ ID NO.1, and the encoded amino acid sequence of the monascus phy gene is shown asSEQ ID NO. 2. The application specifically comprises the following step: constructing a displacement type gene targeting vector to knock out the phy gene. The yield of the obtained phy gene knockout strain red kojic rice solid-state fermentation monascin is 3.66 times higher than the yield of an original strain, and the yield of ankaflavin is increased by 81.5%.

Description

technical field [0001] The invention relates to the field of microbial fermentation, in particular to a method for improving yellow pigment production by fermenting monascus fungus with a phy gene and an application thereof. Background technique [0002] Monascus spp. belongs to a filamentous fungus, which was first named by van Tieghem in 1884 (Van Tieghem, 1884). In terms of biological classification, Monascus belongs to the Kingdom of Fungi, Ascomycota, Euascomycetes, Phytomycetes, Monascus family, and Monascus genus. Currently confirmed Monascus species include: Monascus.argentinensis, M.eremophilus, M.floridanus, M.lunisporas, M.pallens, M.pilosus, M.purpureus, M.ruber and M.sanguineus, among which M.pilosus , M.purpureus, M.ruber are widely used in industry. Monascus is a microorganism that has received much attention in recent years. It can produce a large number of beneficial primary and secondary metabolites, such as amylase, dextrinase, protease, maltase, glucoam...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12N15/31C12N15/90C07K14/37C12P17/18C12R1/645
CPCC07K14/37C12N15/902C12P17/181
Inventor 王玉荣郭晓宇崔海燕李瑶张蕊陈勉华
Owner TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY