Monascus phy gene and application thereof in increasing yield of yellow pigment
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of Monascus and yellow pigment, which is applied in the field of phy gene to improve the production of yellow pigment by fermentation of Monascus, and can solve the problems of high cost and low yield.
Active Publication Date: 2020-03-31
TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF0 Cites 4 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, yellow pigments mainly include artificial synthesis, plant
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment Construction
[0019] Below in conjunction with embodiment, the present invention is further described; Following embodiment is illustrative, not limiting, can not limit protection scope of the present invention with following embodiment. Monascus cultivation mentioned in the examples, DNA extraction, PCR amplification, digestion, connection, transformation, identification of positive clones, red yeast rice solid-state fermentation and other processes, if no special instructions, all adopt conventional methods in this field It can be realized, and will not be repeated as a parallel method described in the present invention.
[0020] (1) Using the CTAB method (Shao Yanchun, Li Li, Yang Sha, Zhao Ying, Wang Xiaohong, & Chen Fusheng, 2009) to extract Monascus genomic DNA
[0021] (2) Use the primer sh-F of the upstream homology arm of the gene phy: GGGGTACCTTCATCTTCTCGGTTTA, sh-R: GCTCTAGAGGGCGTATGCTAGTATCT to amplify 968 bp of the sequence of the upstream homology arm of the phy gene, and use ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention discloses a monascus phy gene and application thereof in increasing the yield of yellow pigment. The monascus phy gene disclosed by the invention plays an important role in increasing the yield of the yellow pigment fermented by monascus, the nucleotide sequence of the monascus phy gene is shown as SEQ ID NO.1, and the encoded amino acid sequence of the monascus phy gene is shown asSEQ ID NO. 2. The application specifically comprises the following step: constructing a displacement type gene targeting vector to knock out the phy gene. The yield of the obtained phy gene knockout strain red kojic rice solid-state fermentation monascin is 3.66 times higher than the yield of an original strain, and the yield of ankaflavin is increased by 81.5%.
Description
technical field [0001] The invention relates to the field of microbial fermentation, in particular to a method for improving yellow pigment production by fermenting monascus fungus with a phy gene and an application thereof. Background technique [0002] Monascus spp. belongs to a filamentous fungus, which was first named by van Tieghem in 1884 (Van Tieghem, 1884). In terms of biological classification, Monascus belongs to the Kingdom of Fungi, Ascomycota, Euascomycetes, Phytomycetes, Monascus family, and Monascus genus. Currently confirmed Monascus species include: Monascus.argentinensis, M.eremophilus, M.floridanus, M.lunisporas, M.pallens, M.pilosus, M.purpureus, M.ruber and M.sanguineus, among which M.pilosus , M.purpureus, M.ruber are widely used in industry. Monascus is a microorganism that has received much attention in recent years. It can produce a large number of beneficial primary and secondary metabolites, such as amylase, dextrinase, protease, maltase, glucoam...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more