Monascus phy gene and application thereof in increasing yield of yellow pigment
A technology of Monascus and yellow pigment, which is applied in the field of phy gene to improve the production of yellow pigment by fermentation of Monascus, and can solve the problems of high cost and low yield.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0019] Below in conjunction with embodiment, the present invention is further described; Following embodiment is illustrative, not limiting, can not limit protection scope of the present invention with following embodiment. Monascus cultivation mentioned in the examples, DNA extraction, PCR amplification, digestion, connection, transformation, identification of positive clones, red yeast rice solid-state fermentation and other processes, if no special instructions, all adopt conventional methods in this field It can be realized, and will not be repeated as a parallel method described in the present invention.
[0020] (1) Using the CTAB method (Shao Yanchun, Li Li, Yang Sha, Zhao Ying, Wang Xiaohong, & Chen Fusheng, 2009) to extract Monascus genomic DNA
[0021] (2) Use the primer sh-F of the upstream homology arm of the gene phy: GGGGTACCTTCATCTTCTCGGTTTA, sh-R: GCTCTAGAGGGCGTATGCTAGTATCT to amplify 968 bp of the sequence of the upstream homology arm of the phy gene, and use ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


