Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of histone modifying enzyme gene setd8 in anti-DNA virus

A DNA virus and modified enzyme technology, applied in the field of gene function and application, can solve the problems of no obvious pathogenicity and weak pathogenicity of HCMV

Active Publication Date: 2021-08-03
WUHAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the incidence of HCMV infection is high, HCMV is less pathogenic and is not significantly pathogenic to immunocompetent individuals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of histone modifying enzyme gene setd8 in anti-DNA virus
  • Application of histone modifying enzyme gene setd8 in anti-DNA virus
  • Application of histone modifying enzyme gene setd8 in anti-DNA virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: the expression level and genome level detection of HSV-1, HCMV and MCVM

[0030] 1. Design primers

[0031] The primers for detection of virus expression and genome level were designed according to the genome sequence and coding sequence of herpes simplex virus type I HSV-1, HCMV and MCMV in NCBI. In this embodiment, US11, a late gene of HSV, is selected as a reference for the transcription level of HSV-1 gene.

[0032] 1) US11 gene PCR amplification primers

[0033] Upstream primer: CTTCAGATGGCTTCGAGATCGTAG, the sequence of which is shown in SEQ ID NO.1;

[0034] Downstream primer: TGTTTACTTAAAAGGCGTGCCGT, whose sequence is shown in SEQ ID NO.2;

[0035] 2) HSV-1 genome PCR amplification primers

[0036] Upstream primer: CTTCAGATGGCTTCGAGATCGTAG, whose sequence is shown in SEQ ID NO.3;

[0037] Downstream primer: TGTTTACTTAAAAGGCGTGCCGT, whose sequence is shown in SEQ ID NO.4;

[0038] 3) HCMV genome PCR amplification primers

[0039] Upstream prim...

Embodiment 2

[0055] Example 2: Knocking down SETD8 in U2OS cells can inhibit the expression and replication of herpes simplex virus HSV-1 infected cells

[0056] 1. Design siRAN

[0057] siRNA was designed according to the coding sequence of SETD8 in NCBI, and siNC was a negative control not targeting any gene. It was then synthesized at Gemma Genetics.

[0058] 1) siSETD8.1 sequence: 5'CGAAGGAGCUCCAGGAAGAUU3', the sequence of which is shown in SEQ ID NO.9;

[0059] 2) siSETD8.2 sequence: 5'CCAUGAAGUCCGAGGAACAUU3', the sequence of which is shown in SEQ ID NO.10;

[0060] 3) siSETD8.3 sequence: 5'GCAACAGAAUCGCAAACUUUU3', the sequence of which is shown in SEQ ID NO.11;

[0061] 4) siSETD8.4 sequence: 5'GCAAACUUACGGAUUUCUAUU 3', the sequence of which is shown in SEQ ID NO.12;

[0062] 2. Subculture of osteosarcoma cells U2OS cells

[0063] Take U2OS cells in good growth state, discard the medium, wash twice with PBS, digest with 0.25% trypsin, inoculate 1*10^6 cells into a 10cm well plat...

Embodiment 3

[0073] Example 3: Overexpression of SETD8 in U2OS cells can promote the infection of HSV-1

[0074] 1. Construct pcDNA5-Flag-SETD5 plasmid by recombination method

[0075] (1) According to the pcDNA5-Flag vector sequence and the coding sequence of SETD8 in the NCBI database, design the recombination primers.

[0076] a Design SETD8 primers

[0077] Forward:

[0078] GCGGATCCACTAGTCCAGTAATGGCTAGAGGCAGGAAGATGTC, whose sequence is shown in SEQ ID NO.13;

[0079] Reverse:

[0080] ATATCTGCAGAATTCCACCATTAATGCTTCAGCCACGGGT, the sequence of which is shown in SEQ ID NO.14;

[0081] b Design pcDNA5-Flag vector primers

[0082] Forward: TGGTGGAATTCTGCAGATATC, the sequence of which is shown in SEQ ID NO.15;

[0083] Reverse: CACTGGACTAGTGGATCCGCC, the sequence of which is shown in SEQ ID NO.16;

[0084] (2) PCR amplification produces recombinant SETD8 fragment and recombinant pcDNA5-Flag fragment.

[0085] The cDNA extracted in Example 4 was used as a template, and PCR was perfor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of a histone modifying enzyme gene SETD8 in anti-DNA virus. The present invention confirms the relationship between SETD8 gene and DNA virus infection, which can be used as a therapeutic target for DNA virus infection, can be used to antagonize DNA virus infection by inhibiting SETD8, and its inhibitor UNC0379 can be used for the treatment of DNA infection. The present invention mainly discusses (1) inhibiting the expression of SETD8 can inhibit the expression and replication of DAN virus. (2) Overexpression of SETD8 can promote the expression and replication of DNA viruses. (3) UNC0379, a small molecule inhibitor of SETD8, can inhibit the infection of DNA viruses. The invention provides an effective new way for the treatment of DNA virus infection.

Description

technical field [0001] The invention belongs to the field of gene function and application, and specifically refers to the application of a histone modifying enzyme gene SETD8 in anti-DNA virus. Background technique [0002] DNA virus infection is a major threat to human health, and HSV infection is becoming more and more serious. Herpes simplex virus (HSV) belongs to the Herpesviridae family and is an enveloped, thread-bound DNA double-stranded virus. They exist widely in nature, there are about 100 kinds, and they are divided into three subfamilies of α, β, and γ according to their physical and chemical characteristics and biological characteristics. HSV belongs to α subfamily, including HSV-1 and HSV-2. HSV-1 mainly infects the skin and mucous membranes of the mouth, eyes, lips, and the central nervous system, and a small amount of genital infection; HSV-2 is generally related to external genital infection and neonatal infection, and is rarely seen in oral lesions. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/686A61K45/00A61P31/22
CPCA61K45/00A61P31/22C12Q1/686C12Q1/705C12Q2600/136C12Q2600/158C12Q2521/107
Inventor 吴旻陈林杨晨
Owner WUHAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com