Application of histone modifying enzyme gene setd8 in anti-DNA virus
A DNA virus and modified enzyme technology, applied in the field of gene function and application, can solve the problems of no obvious pathogenicity and weak pathogenicity of HCMV
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Embodiment 1: the expression level and genome level detection of HSV-1, HCMV and MCVM
[0030] 1. Design primers
[0031] The primers for detection of virus expression and genome level were designed according to the genome sequence and coding sequence of herpes simplex virus type I HSV-1, HCMV and MCMV in NCBI. In this embodiment, US11, a late gene of HSV, is selected as a reference for the transcription level of HSV-1 gene.
[0032] 1) US11 gene PCR amplification primers
[0033] Upstream primer: CTTCAGATGGCTTCGAGATCGTAG, the sequence of which is shown in SEQ ID NO.1;
[0034] Downstream primer: TGTTTACTTAAAAGGCGTGCCGT, whose sequence is shown in SEQ ID NO.2;
[0035] 2) HSV-1 genome PCR amplification primers
[0036] Upstream primer: CTTCAGATGGCTTCGAGATCGTAG, whose sequence is shown in SEQ ID NO.3;
[0037] Downstream primer: TGTTTACTTAAAAGGCGTGCCGT, whose sequence is shown in SEQ ID NO.4;
[0038] 3) HCMV genome PCR amplification primers
[0039] Upstream prim...
Embodiment 2
[0055] Example 2: Knocking down SETD8 in U2OS cells can inhibit the expression and replication of herpes simplex virus HSV-1 infected cells
[0056] 1. Design siRAN
[0057] siRNA was designed according to the coding sequence of SETD8 in NCBI, and siNC was a negative control not targeting any gene. It was then synthesized at Gemma Genetics.
[0058] 1) siSETD8.1 sequence: 5'CGAAGGAGCUCCAGGAAGAUU3', the sequence of which is shown in SEQ ID NO.9;
[0059] 2) siSETD8.2 sequence: 5'CCAUGAAGUCCGAGGAACAUU3', the sequence of which is shown in SEQ ID NO.10;
[0060] 3) siSETD8.3 sequence: 5'GCAACAGAAUCGCAAACUUUU3', the sequence of which is shown in SEQ ID NO.11;
[0061] 4) siSETD8.4 sequence: 5'GCAAACUUACGGAUUUCUAUU 3', the sequence of which is shown in SEQ ID NO.12;
[0062] 2. Subculture of osteosarcoma cells U2OS cells
[0063] Take U2OS cells in good growth state, discard the medium, wash twice with PBS, digest with 0.25% trypsin, inoculate 1*10^6 cells into a 10cm well plat...
Embodiment 3
[0073] Example 3: Overexpression of SETD8 in U2OS cells can promote the infection of HSV-1
[0074] 1. Construct pcDNA5-Flag-SETD5 plasmid by recombination method
[0075] (1) According to the pcDNA5-Flag vector sequence and the coding sequence of SETD8 in the NCBI database, design the recombination primers.
[0076] a Design SETD8 primers
[0077] Forward:
[0078] GCGGATCCACTAGTCCAGTAATGGCTAGAGGCAGGAAGATGTC, whose sequence is shown in SEQ ID NO.13;
[0079] Reverse:
[0080] ATATCTGCAGAATTCCACCATTAATGCTTCAGCCACGGGT, the sequence of which is shown in SEQ ID NO.14;
[0081] b Design pcDNA5-Flag vector primers
[0082] Forward: TGGTGGAATTCTGCAGATATC, the sequence of which is shown in SEQ ID NO.15;
[0083] Reverse: CACTGGACTAGTGGATCCGCC, the sequence of which is shown in SEQ ID NO.16;
[0084] (2) PCR amplification produces recombinant SETD8 fragment and recombinant pcDNA5-Flag fragment.
[0085] The cDNA extracted in Example 4 was used as a template, and PCR was perfor...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


