Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant fusion protein OspC-VlsE of Lyme and application thereof

A technology of fusion protein and Lyme, applied in the field of genetic engineering, can solve the problem of low specificity and achieve the effect of large expression, low cost and short cycle

Active Publication Date: 2020-04-17
HANGZHOU AORUI BIOMEDICINE TECH
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Antigens used in the serological diagnosis of Lyme disease include whole-bacteria antigen and recombinant antigen. Cross-reactivity, low specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1 Contains the construction of Lyme recombinant fusion protein OspC-VlsE gene expression vector

[0025] Lyme recombinant fusion protein OspC-VlsE gene is designed according to the protein sequences of OspC (NCBI Sequence ID: CAG44438.1) and VlsE (NCBI Sequence ID: ACC99642.1). The antigenic epitopes on it were analyzed, and the most dominant antigenic epitopes were selected for fusion.

[0026] According to the amino acid sequence, the Escherichia coli codon was used to reverse-translate it into a nucleotide sequence, and the obtained nucleotide sequence was as follows: The recombinant gene sequence SEQ ID NO.2 was synthesized by Shanghai Jierui Bioengineering Co., Ltd., and the vector was pET30a.

[0027] SEQ ID NO.2:

[0028]AACACCAGCGCGAACAGCGCGGATGAAAGCGTGAAAGGCCCGAACCTGACCGAAATTAGCAAAAAAATTACCGATAGCAACGCGGTGCTGCTGGCGGTGAAAGAAGTGGAAGCGCTGCTGAGCAGCATTGATGAAATTGCGGCGAAAGCGATTGGCAAAAAAATTCATCAGAACAACGGCCTGGATACCGAAAACAACCATAACGGCAGCCTGCTGGCGGGCGCGTATGCGATT...

Embodiment 2

[0029] Embodiment 2 contains the expression of Lyme recombinant fusion protein OspC-VlsE

[0030] The synthetic Lyme recombinant fusion protein OspC-VlsE plasmid was transformed into Escherichia coli BL21, spread on an LB plate containing 50ug / ml kanamycin (Shanghai Shenggong, product number: K0408), and cultivated overnight at 37. Pick a monoclonal colony, culture it with 300ml LB medium containing the same concentration of kanamycin at 37 degrees until the OD600 reaches about 0.6, and induce expression with IPTG (Shanghai Shenggong, product number: IB0168) with a final concentration of 1mM. The conditions are: 37 degrees, rotating speed 200rpm, 4h. After induction, the culture solution was centrifuged at 4°C at 7000 rpm for 10 minutes to collect the bacteria.

Embodiment 3

[0031] Example 3 Purification and renaturation of Lyme-containing recombinant fusion protein OspC-VlsE

[0032] Use 50ml of loading buffer Binding Buffer (50mM Tris, 0.2M Nacl, pH8.0) to break up the bacteria, and then ultrasonically break it at 400w, ultrasonic for 3s, with an interval of 6s, a total of 180 times, and finally 12000rpm, 30min, 4 degrees Collect the supernatant by centrifugation, and the target protein is in the supernatant. Next, it was purified by Ni+ column, and the target protein was eluted with Elution Buffer (50mM Tris, 0.2M Nacl, 0.5M Imidazole, pH8.0). The purified recombinant protein was dialyzed with dialysis buffer (50 mM Tris, 0.2 M Nacl, pH 8.0), and the dialysis solution was changed every 12 hours for a total of 3 times. The dialyzed protein solution was taken out, filtered through a 0.22um filter, and the concentration was measured by the BCA method, and stored at -20°C for future use.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant fusion protein OspC-VlsE of Lyme. The recombinant fusion protein OspC-VlsE is characterized in that the amino acid sequence of the recombinant fusion protein OspC-VlsE is as shown in SEQ ID NO. 1. According to the invention, the recombinant fusion protein OspC-VlsE is expressed in an Escherichia coli system by utilizing a genetic engineering recombination technology, and the advantages of short production period, high yield, low cost and good specificity are obtained. The recombinant fusion protein can be used as a part of a recombinant protein detection kit for the Lyme disease.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a fusion protein expressing recombinant Lyme OspC-VlsE in Escherichia coli system and its production method and application. Background technique [0002] Lyme disease is a tick-borne zoonotic disease caused by Borrelia burgdorferi. The clinical symptoms of Lyme disease include: erythema migrans, facial nerve paralysis, radiculitis, heart disease, arthritis and chronic atrophic extremity dermatitis, etc., leading to permanent disability or even death in severe cases. Because the clinical symptoms of Lyme disease are complex and diverse, laboratory-assisted diagnosis of Lyme disease is particularly important. [0003] The laboratory diagnosis of Lyme disease mainly relies on serological diagnostic methods, including IFA, ELISA, WB, etc. The antigens used in the serological diagnosis of Lyme disease include whole-bacteria antigen and recombinant antigen. Cross-reactivity, low ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70G01N33/569G01N33/558
CPCC07K14/20C07K2319/00C12N15/70C12N2800/22G01N33/558G01N33/56911G01N2333/20G01N2469/20Y02A50/30
Inventor 阮美丽吴晓杰吴银飞
Owner HANGZHOU AORUI BIOMEDICINE TECH