Method for modifying ubiquitin and inhibiting ubiquitination pathway

A technology of ubiquitination and ubiquitin, which is applied in the field of life science and microbial protein function and application, and can solve the problem that the modification is not the final product

Active Publication Date: 2020-05-15
ZHEJIANG UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this type of effector protein also performs arginine ADP ribosylation modification on ubiquitin, this modification is not the final product, but an intermediate process of catalysis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for modifying ubiquitin and inhibiting ubiquitination pathway
  • Method for modifying ubiquitin and inhibiting ubiquitination pathway
  • Method for modifying ubiquitin and inhibiting ubiquitination pathway

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Expression and purification of CteC recombinant protein

[0027] 1. Construction of expression plasmid

[0028] Using the genomic DNA of Chromobacterium violaceum ATCC 12472 strain as a template, primers F1: GATAGGATCCATGCTATTTTTCACCGGTCTGC (SEQ ID NO. 1) and R1: GATACTCGAGTTAGACCGACGCCAACTCCTG (SEQ ID NO. 2) were designed according to the gene sequence (CV_1647) on NCBI to obtain CteC by PCR amplification Full length target fragment.

[0029] The CteC full-length target fragment was constructed into the kanamycin-resistant prokaryotic expression plasmid pRSF-Duet-His-SUMO vector (the vector is in pRSF-Duet1) by restriction digestion (the restriction sites are BamH1 and Xho1) and ligation. (Novagen), pRSF-Duet1-His-SUMO-CteC is obtained by inserting SUMO protein after His tag. His tag protein can be affinity purified with Ni magnetic beads, and SUMO protein can be specifically recognized by Ulp1 enzyme for subsequent excision of tag protein.

[0030] 2. Protein expression

[0...

Embodiment 2

[0034] Example 2: Effector protein CteC on ADP ribosylation modification of ubiquitin molecules

[0035] In a 15μL reaction system (the reaction buffer is 20mM HEPES pH 7.4, 150mM NaCl), add 1μM Ub (the protein purification method is the same as the reference Wan et al., 2019, doi:10.1038 / s41564-019-0454-1) And 0.1 μM of the CteC protein purified in Example 1, set the NAD concentration gradients to 0, 0.25, 2.5, 25, 250, 2500 μM, and after reacting at 37°C for 30 minutes, run 15% SDS-PAGE and 8% Native PAGE, respectively If Ub undergoes a modification reaction, it can migrate upward on 15% SDS-PAGE gel, and migrate downward on 8% Native PAGE. In vitro biochemical experiments show that the modification of Ub by CteC needs to rely on NAD as a ligand ( figure 2 ), and the modified Ub can be recognized by the ADPr antibody (MABE1016, Millipore) ( image 3 ). Through sequence alignment analysis, it is found that CteC is similar to some ARTs and has a conservative "RSE motif" ( Figu...

Embodiment 3

[0038] Example 3 The effect of the effector protein CteC on the ADP ribosylation modification of ubiquitin molecules on the ubiquitination pathway and host cells.

[0039] Ubiquitin molecules participate in various signal pathways after forming different forms of ubiquitin chains through cascade reactions. Using different E2 and E3 will form a specific form of ubiquitin chain. In this example, UbcH5c and IpaH3 were used to synthesize K48 chain, and Uev1a, Ubc13 and TRAF6 were used to synthesize K63 chain. (Refer to Wanet al., 2019, doi: 10.1038 / s41564-019-0454-1 for protein particle information and purification methods involved in this embodiment) The experimental results show that the efficiency of CteC-modified Ub in the formation of K48 and K63 chains in vitro is greatly reduce( Picture 9 ).

[0040] The NF-κB signaling pathway plays an important role in the cellular immune response, and the degradation of IκBα is an indicator to detect whether this pathway is activated. The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a method for modifying ubiquitin and inhibiting an ubiquitination pathway. The modification is achieved by a family of effector proteins secreted by a type III secretion system in Gram-negative bacteria. The family of the effector proteins is a type of adenosine diphosphate (ADP) ribosyl transferase, specifically performs single ADP ribosylation modification on threonine residue at a 66th locus of a ubiquitin molecule in eukaryotes, and also is free of modification on ubiquitin-like proteins SUMO and NEDD8. The modification of the ubiquitin cannot be reversiblyde-modified by hydrolytic enzymes capable of removing ADP ribosylation in eukaryotic cells, and thus effectively destroys ubiquitin-mediated signaling pathways in host cells. The method plays important functions on killing tumor cells, changing cell signaling pathways, etc.

Description

Technical field [0001] The present invention relates to the field of life sciences and microbial protein function and application technology, in particular to a new method of specific modification of ubiquitin molecules and the enzymatic activity of effector protein CteC as ADP ribosyltransferase and the enzyme's research on ADP ribosylation In the role. Background technique [0002] ADP ribosylation (ADPr) is a reversible regulatory mechanism that is widely present in viruses, bacteria and most eukaryotic organisms. ADP ribosyltransferases (ARTs) transfer the adenosine diphosphate (ADP) ribosyl group from NAD to the substrate protein and release nicotinamide. ADPr regulates many important physiological processes of cells, such as DNA damage repair, transcription, cell division, proliferation, and cell death. In addition, ADPr is also involved in the pathogenesis of many human diseases, including neurological diseases, cancer, and bacterial or viral infections. ARTs also exist...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/54C12N15/85C12N5/10
CPCC12N9/1077C12N15/85
Inventor朱永群周艳黄春峰阎芙洁
OwnerZHEJIANG UNIV