Unlock instant, AI-driven research and patent intelligence for your innovation.

GPC3-targeted chimeric antigen receptor

A technology of chimeric antigen receptors and carriers, which is applied in the field of targeting GPC3 chimeric antigen receptors, and can solve problems such as inability to achieve good curative effect

Inactive Publication Date: 2020-06-30
HRAIN BIOTECHNOLOGY CO LTD
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The GPC3-GC33 antibody in 15 patients was observed to have a significant therapeutic effect in the phase I clinical trial for the treatment of HCC. It is speculated that the naked antibody will not have a good effect against human liver cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GPC3-targeted chimeric antigen receptor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1: Determination of the GPC3CAR gene sequence

[0018] The heavy chain and light chain variable region gene sequence information (GC33) of the anti-GPC3 antibody was searched from the NCBI website database, and the sequence was codon-optimized on the website http: / / sg.idtdna.com / site to ensure that the encoded amino acid sequence does not It is more suitable for expression in human cells under variable conditions.

[0019] For the nucleotide and amino acid sequence information of each gene, see (SEQUUNCE ID NO.1-2)

[0020] The above sequences were connected in sequence, and different enzyme cutting sites were introduced at the junctions of each sequence to form the complete sequence information of the GPC3CAR gene.

Embodiment 2

[0021] Embodiment 2: the construction of the viral vector comprising the nucleic acid sequence of CAR molecule

[0022] The nucleotide sequence of the CAR molecule prepared in Example 1 was double digested with NotI (NEB) and EcoRI (NEB), connected and inserted into the NotI-EcoRI site of the retroviral RV vector through T4 ligase (NEB), and transformed into When the competent E.coli (DH5α) was obtained, the recombinant plasmid was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the sequencing result was compared with the fitted GPC3CAR sequence to verify whether the sequence was correct. The sequencing primers are:

[0023] Sense sequence: AGCATCGTTCTGTGTTGTCTC (SEQUENCE ID NO.3)

[0024] Antisense sequence: TGTTTGTCTTGTGGCAATACAC (SEQUUNCE ID NO.4)

[0025] After the sequencing was correct, the plasmid was extracted and purified using a plasmid purification kit from Qiagen, and the purified plasmid was transfected into 293T cells by the plasmid calcium ...

Embodiment 3

[0027] Example 3: Retroviral packaging

[0028] 1. On the first day, the 293T cells should be less than 20 passages and not overgrown. Plate at 0.6*10^6 cells / ml, add 10ml of DMEM medium to a 10cm dish, mix the cells well, and culture overnight at 37 degrees.

[0029] 2. On the second day, the 293T cell confluency reaches about 90% for transfection (usually about 14-18 hours after plating); prepare the plasmid complex, the amount of various plasmids is 12.5ug for Retro backbone (MSCV), and 12.5ug for Gag-pol 10ug, VSVg is 6.25ug, CaCl 2 250ul,H 2 O is 1ml and the total volume is 1.25ml; add HBS equal to the volume of the plasmid complex in another tube, and vortex for 20 seconds while adding the plasmid complex. Gently add the mixture to the 293T dish along the side, incubate at 37°C for 4 hours, remove the medium, wash it with PBS, and add pre-warmed fresh medium again.

[0030] 3. Day 4: 48 hours after transfection, collect the supernatant and filter it with a 0.45um fi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a GPC3-targeted chimeric antigen receptor and an application thereof, and particularly provides a polynucleotide sequence. The polynucleotide sequence is selected from: (1) asequence containing an MASK coding sequence, an anti-GPC3 single chain antibody coding sequence, a human CD8alpha hinge region coding sequence, a human CD8 transmembrane region coding sequence, a human 41BB intracellular region coding sequence and a human CD3zeta intracellular region coding sequence which are connected sequentially; and (2) a complementary sequence of the polynucleotide sequence of (1). The invention also provides related fusion protein, a vector containing the coding sequences, and applications of the fusion protein, the coding sequences and the vector.

Description

technical field [0001] The invention belongs to the field of chimeric antigen receptors, and in particular relates to targeting GPC3 chimeric antigen receptors and uses thereof. Background technique [0002] Liver cancer is the fifth most prevalent tumor and the third most common cause of cancer-related death in the world (Bosch et al., Gastroenterology 127:S5-S16, 2004; El–Serag et al., Gastroenterology 132:2557 76, 2007). According to the American Cancer Society, hepatocellular carcinoma (HCC) accounts for approximately 75 percent of liver cancer cases, and symptoms are often not present until advanced stages of liver cancer. Surgery is the standard treatment for liver cancer because this type of cancer does not respond well to most chemotherapy drugs. Therefore, there is an urgent need to develop new drugs with different mechanisms of action. [0003] Glypican 3 (GPC3) is a cell surface protein belonging to the heparan sulfate proteoglycan family. The GPC3 gene codes ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/867C12N5/10A61K35/17A61P35/00
CPCA61K35/17A61P35/00C07K14/7051C07K16/303C07K2317/622C07K2319/03C12N5/0636C12N5/0646C12N15/86C12N2510/00C12N2740/10043C12N2740/15043
Inventor 王海鹰
Owner HRAIN BIOTECHNOLOGY CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More