Check patentability & draft patents in minutes with Patsnap Eureka AI!

Multi-target fusion protein capable of blocking growth of vascular endothelial cells and activating T cells, and pharmaceutical composition comprising multi-target fusion protein

A technology of fusion protein and vascular endothelium, applied in the field of medicine and biology, can solve the problem that the five-year survival rate of lung cancer is only 16%

Pending Publication Date: 2020-07-17
BEIJING BIYANG BIOTECH
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, a considerable number of tumor patients do not respond to or develop resistance to single-targeted tumor therapy. For example, the average effective rate of current anti-PD-1 and PD-L1 antibody drugs is only about 20%. Survival rate is only 16%

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multi-target fusion protein capable of blocking growth of vascular endothelial cells and activating T cells, and pharmaceutical composition comprising multi-target fusion protein
  • Multi-target fusion protein capable of blocking growth of vascular endothelial cells and activating T cells, and pharmaceutical composition comprising multi-target fusion protein
  • Multi-target fusion protein capable of blocking growth of vascular endothelial cells and activating T cells, and pharmaceutical composition comprising multi-target fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0158] Embodiment 1, the construction of the high-efficiency expression vector of glutamine synthetase comprising target gene

[0159] (1) Synthesis of encoding nucleotides of anti-PD1 antibody BY18.1 and construction of expression vectors

[0160] According to the amino acid sequence data of Nivolumab No. 9623 in the International Nonproprietary Name (INN) database, it was optimized to the following nucleotide sequence suitable for expression in Chinese hamster ovarian cancer cells (CHO), and commissioned by Shanghai Jierui Biotech Co., Ltd. Engineering Ltd. synthesized the nucleotide sequence. The anti-PD1 antibody produced after expression of said nucleotide sequence is denoted herein as antibody BY18.1.

[0161] Nucleotide sequence (SEQ ID NO: 73) of the light chain (BY18.1L) of anti-PD1 antibody BY18.1:

[0162] CTCGAGGCCACCATGGAGACCGACACACTCCTCCTGTGGGTGCTGCTGCTGTGGGTGCCTGGCTCCACTGGCGAGATTGTGCTGACACAGTCCCCCGCTACTCTGAGCCTGAGCCCTGGCGAGAGGGCTACACTGTCTTGCAGAGCTTCTCAGTCCGTGT...

Embodiment 2

[0211] Embodiment 2, expression and purification of target protein

[0212] (1) Transient expression of target protein

[0213] 293F (purchased from Invitrogen, catalog number: 11625-019) cells were suspended and cultured in serum-free CD 293 medium (purchased from Invitrogen, catalog number: 11913-019). Centrifuge the cell culture before transfection to obtain the cell pellet, suspend the cells with fresh serum-free CD 293 medium, and adjust the cell concentration to 1×10 6 cells / ml. Place the cell suspension in shake flasks. Taking 100ml of cell suspension as an example, 250ug of DNA and 500ug of polyethyleneimine (polyethyleneimine (PEI)) (Sigma, catalog number: 408727) were added to each recombinant expression vector plasmid containing the gene of interest prepared in Example 1. Mix well in 1ml of serum-free CD 293 culture medium, let it stand at room temperature for 8 minutes, then add the PEI / DNA suspension dropwise into the shake flask with 100ml of cell suspension. ...

Embodiment 3

[0220] Embodiment 3, use ELISA method to detect specific binding effect

[0221] Recombinant human CD28 (product of Beijing Yiqiao Shenzhou Biotechnology Co., Ltd., catalog number: 50103-M08H), recombinant human PD-L1 (Beijing Baipusaisi Biotechnology Co., Ltd., catalog number: PD1-H5229) and recombinant human CTLA-4 (product of Beijing Yiqiao Shenzhou Biotechnology Co., Ltd., catalog number: 11159-H08H) was diluted to 0.5 μg / ml, 0.25 μg / ml and 1.0 μg / ml and coated with 96-well ELISA plate (Corning Company, catalog number: 42592). Dilute the fusion proteins BY24.4, BY24.5, BY24.12, and BY31.19 purified in the above-mentioned Example 2 (2) to 2000 μg / ml, then perform 3-fold serial dilutions, and dilute 16 gradients in total. For each Concentration gradients were used for repeated well detection. Add 50 μl of the diluted sample to the 96-well plate coated with recombinant human CD28, recombinant human CTLA-4 or recombinant human PD-L1, and incubate at 37°C for 2 hours. After ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a multi-target fusion protein capable of blocking growth of vascular endothelial cells and activating T cells. The multi-targeted fusion protein comprises (i) a vascularendothelial growth inhibition structural domain; (ii) an immunoglobulin Fc structural domain; and (iii) a CD80 extracellular domain (ECD). The invention also provides a polynucleotide encoding the multi-target fusion protein, a vector comprising the polynucleotide, a host cell comprising the polynucleotide or vector, and a pharmaceutical composition comprising the multi-target fusion protein andan anti-PD-1 antibody. The multi-target fusion protein and pharmaceutical composition provided by the invention can treat or prevent cancerous diseases in an individual.

Description

technical field [0001] The present invention generally relates to the field of medical biotechnology. Specifically, the present invention relates to a multi-targeting fusion protein comprising (i) vascular endothelial cell growth inhibitor domain; (ii) immunoglobulin Fc domain; and (iii) CD80 extracellular domain (ECD), encoding the The polynucleotide of the multi-targeting fusion protein, the carrier comprising the polynucleotide, the host cell comprising the polynucleotide or the vector, and the pharmaceutical combination comprising the multi-targeting fusion protein and anti-PD-1 antibody things. The multi-targeting fusion proteins and pharmaceutical compositions of the present invention can treat or prevent cancerous diseases in individuals. Background technique [0002] The tumor microenvironment is a complex environment for the survival and development of tumor cells. It is composed of cellular components and non-cellular components, of which cellular components incl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00A61K39/395A61K47/64A61P35/00
CPCC07K14/70532C07K16/22C07K16/2863C07K14/71A61K39/3955A61K47/6425A61P35/00C07K2319/30C07K2317/565C07K2317/55C07K2317/31A61K2300/00A61K39/395C07K2319/00C07K2317/14C07K2317/76C07K2317/21C07K16/2818C07K2317/92A61K47/68A61K47/6811A61K2039/505
Inventor 胡品良邹敬洪伟东何芸白洁宋凌云杨文第
Owner BEIJING BIYANG BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More