Multi-target fusion protein capable of blocking growth of vascular endothelial cells and activating T cells, and pharmaceutical composition comprising multi-target fusion protein
A technology of fusion protein and vascular endothelium, applied in the field of medicine and biology, can solve the problem that the five-year survival rate of lung cancer is only 16%
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0158] Embodiment 1, the construction of the high-efficiency expression vector of glutamine synthetase comprising target gene
[0159] (1) Synthesis of encoding nucleotides of anti-PD1 antibody BY18.1 and construction of expression vectors
[0160] According to the amino acid sequence data of Nivolumab No. 9623 in the International Nonproprietary Name (INN) database, it was optimized to the following nucleotide sequence suitable for expression in Chinese hamster ovarian cancer cells (CHO), and commissioned by Shanghai Jierui Biotech Co., Ltd. Engineering Ltd. synthesized the nucleotide sequence. The anti-PD1 antibody produced after expression of said nucleotide sequence is denoted herein as antibody BY18.1.
[0161] Nucleotide sequence (SEQ ID NO: 73) of the light chain (BY18.1L) of anti-PD1 antibody BY18.1:
[0162] CTCGAGGCCACCATGGAGACCGACACACTCCTCCTGTGGGTGCTGCTGCTGTGGGTGCCTGGCTCCACTGGCGAGATTGTGCTGACACAGTCCCCCGCTACTCTGAGCCTGAGCCCTGGCGAGAGGGCTACACTGTCTTGCAGAGCTTCTCAGTCCGTGT...
Embodiment 2
[0211] Embodiment 2, expression and purification of target protein
[0212] (1) Transient expression of target protein
[0213] 293F (purchased from Invitrogen, catalog number: 11625-019) cells were suspended and cultured in serum-free CD 293 medium (purchased from Invitrogen, catalog number: 11913-019). Centrifuge the cell culture before transfection to obtain the cell pellet, suspend the cells with fresh serum-free CD 293 medium, and adjust the cell concentration to 1×10 6 cells / ml. Place the cell suspension in shake flasks. Taking 100ml of cell suspension as an example, 250ug of DNA and 500ug of polyethyleneimine (polyethyleneimine (PEI)) (Sigma, catalog number: 408727) were added to each recombinant expression vector plasmid containing the gene of interest prepared in Example 1. Mix well in 1ml of serum-free CD 293 culture medium, let it stand at room temperature for 8 minutes, then add the PEI / DNA suspension dropwise into the shake flask with 100ml of cell suspension. ...
Embodiment 3
[0220] Embodiment 3, use ELISA method to detect specific binding effect
[0221] Recombinant human CD28 (product of Beijing Yiqiao Shenzhou Biotechnology Co., Ltd., catalog number: 50103-M08H), recombinant human PD-L1 (Beijing Baipusaisi Biotechnology Co., Ltd., catalog number: PD1-H5229) and recombinant human CTLA-4 (product of Beijing Yiqiao Shenzhou Biotechnology Co., Ltd., catalog number: 11159-H08H) was diluted to 0.5 μg / ml, 0.25 μg / ml and 1.0 μg / ml and coated with 96-well ELISA plate (Corning Company, catalog number: 42592). Dilute the fusion proteins BY24.4, BY24.5, BY24.12, and BY31.19 purified in the above-mentioned Example 2 (2) to 2000 μg / ml, then perform 3-fold serial dilutions, and dilute 16 gradients in total. For each Concentration gradients were used for repeated well detection. Add 50 μl of the diluted sample to the 96-well plate coated with recombinant human CD28, recombinant human CTLA-4 or recombinant human PD-L1, and incubate at 37°C for 2 hours. After ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com