Unlock instant, AI-driven research and patent intelligence for your innovation.

High-flux low-cost molecular identification technique of trace biological samples

A molecular identification technology and biological sample technology, which is applied in the field of molecular biology, can solve the problems of time-consuming and labor-intensive use, high cost of use, and reduced quality of extracted DNA, achieving high quality and ensuring stability

Active Publication Date: 2020-07-24
ZHEJIANG FORESTRY ACAD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, many researchers have proposed many improvements in DNA extraction methods, but they are often only aimed at one type of microbial sample, such as only for Gram-negative bacteria, which makes it difficult to extract various samples at the same time. For example, intestinal bacteria include Gram-negative bacteria, which are relatively easy to extract DNA, and Gram-positive bacteria, such as Bifidobacteria, which are difficult to extract DNA; moreover, in order to meet the needs of large-scale extraction, the previous large-scale Most improvements tend to oversimplify the extraction process, seriously reducing the quality of the extracted DNA
In terms of sequence detection and analysis, although PCR and classical sequencing methods are very mature and reliable, it is still time-consuming and labor-intensive to sequence thousands of samples, making high-throughput sequencing an astonishing amount of sequencing, but the cost of sequencing each sample Not cheap, expensive to use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 DNA Extraction of Gram-positive Bacteria Bifidobacterium longum

[0036] In bacteria, usually, the DNA of Gram-negative bacteria is relatively easy to extract; Gram-positive bacteria have relatively thick peptidoglycan cell walls, so usually a single heating, freezing and thawing and mechanical disruption are not effective; Method of the present invention obtains better effect;

[0037] 1. Cultivate the target strain to an OD value above 1.0;

[0038] 2. Pipette the bacterial solution into a 200μl 8-tube tube, centrifuge at 10,000g at 4°C for 1min, and remove the supernatant. If the bacterial solution is relatively dilute, it can be repeated 2-3 times; then, add sterile water to wash, and centrifuge to remove the supernatant;

[0039] 3. Add 25 μl glass beads (diameter 0.3 mm), 25 μl 1 mg / ml proteinase K, mix well, and incubate at 60°C for 10 minutes;

[0040] 4. Shake at 1200 rpm for 6 minutes in a microplate mixer;

[0041] 5. Add 50 μl of 10% chelex sol...

Embodiment 2

[0044] Example 2 Using commonly used 16s rRNA primers and PCR amplification to identify intestinal flora

[0045] The standard 16s rRNA universal primer forward is 515F: 5'-GTGCCAGCMGCCGCGG-3', reverse: 907R: 5'-CCGTCAATTCMTTTRAGTTT-3'; now a point mutation crossover combination is used to form a 24×16 primer square (Table 1), corresponding to 384 sample combinations, carry out specific amplification; the amplification results show that for the primers with different site mutations, the PCR effect is obvious, and the size is near the target band, and the experimental results are reliable (see figure 2 );

[0046] Table 1. The sequences and numbers of each primer

[0047] Primer name adapter (underline) + universal primer (5'-3', mutations are marked in lowercase) number

[0048] 1B515F1-A CACTCCATACAGCACGCTCTTCCGATCTTCCCGA aTGCCAGCMGCCGCGGD1

[0049] 1B515F1-B CACTCCATACAGCACGCTCTTCCGATCTTCCCGAtTGCCAGCMGCCGCGGD2

[0050] 1B515F1-C CACTCCATACAGCACGCTCTTCCGATCTTCCCGA ...

Embodiment 3

[0109] Example 3 Sequence tag recognition and reduction to each tube

[0110] Use python software to design the sorting program:

[0111] Program flow: assign all sequenced sequence marker sites to corresponding PCR reaction wells >> select 20-30 sequences from each well and integrate them into a single fasta file >> perform stand-alone BLAST sequence comparison >> perform results in excel Classification and Sorting >> Output homologous comparison results to excel; the execution effect is shown in the following table:

[0112] The first column in the table is the hole position, the second column is the maximum 20 sequences randomly taken out, the third column is the largest possible strain, and the fourth column is the sequence of the strain;

[0113] Cell_position Total_count 1Species 1Hit

[0114] 515F1-D-907R1-9 20 Veillonella dispar 8

[0115] 515F1-E-907R1-9 20 Veillonella dispar 7

[0116] 515F1-H-907R1-11 20 Veillonella dispar 4

[0117] 515F1-I-907R1-6 20 Veillo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of molecular organisms, in particular to a high-flux low-cost molecular identification technique of trace biological samples. The high-flux low-cost molecular identification technique of trace biological samples comprises contents in two respects of high-quality genome extraction and sequence detection and analysis. The invention aims to reduce high-flux sequencing cost of molecular identification of the trace biological samples. The high-flux low-cost molecular identification technique of trace biological samples comprises the following steps of (1) collecting samples; (2) splitting the collected samples; (3) collecting nucleic acid; (4) performing PCR amplification on marked primers; and (5) performing mixed sequencing and position reduction on PCR products. A complicated protoplast does not need to be prepared, receptor sources are simple, and the high-flux low-cost molecular identification technique of trace biological samples is suitable for transformation of fungi without spores. In addition, an existing DNA extraction technique is simplified and improved, a researcher can utilize some simple small-scale equipment in a laboratory, and large-scale high-quality genome extraction is convenient to develop; and besides, ordinary PCR and a high-flux sequencing technique are integrated, computer analysis is combined, and low-cost PCR sequence amplification and sequencing analysis of extracted DNA can be realized.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a high-throughput and low-cost molecular identification technology of trace biological samples, including high-quality genome extraction and sequence detection and analysis of trace biological samples. Background technique [0002] Modern molecular biotechnology has gradually entered the era of high-throughput processing in DNA sample extraction, PCR amplification and sequencing, which is very necessary in many research fields, such as studying the diversity of certain biological loci by molecular means When processing a large number of samples (including animal and plant cells and microorganisms), such high-throughput processing usually relies on expensive automated processing machines and kits. For laboratory research with ordinary conditions, if the genome extraction, PCR amplification and sequencing are performed manually one by one with kits according to conventional...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6806C12Q1/6869
CPCC12Q1/6806C12Q1/6869C12Q2521/537C12Q2531/113C12Q2525/191C12Q2535/122
Inventor 彭华正金群英朱汤军叶华琳
Owner ZHEJIANG FORESTRY ACAD