High-flux low-cost molecular identification technique of trace biological samples
A molecular identification technology and biological sample technology, which is applied in the field of molecular biology, can solve the problems of time-consuming and labor-intensive use, high cost of use, and reduced quality of extracted DNA, achieving high quality and ensuring stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0035] Example 1 DNA Extraction of Gram-positive Bacteria Bifidobacterium longum
[0036] In bacteria, usually, the DNA of Gram-negative bacteria is relatively easy to extract; Gram-positive bacteria have relatively thick peptidoglycan cell walls, so usually a single heating, freezing and thawing and mechanical disruption are not effective; Method of the present invention obtains better effect;
[0037] 1. Cultivate the target strain to an OD value above 1.0;
[0038] 2. Pipette the bacterial solution into a 200μl 8-tube tube, centrifuge at 10,000g at 4°C for 1min, and remove the supernatant. If the bacterial solution is relatively dilute, it can be repeated 2-3 times; then, add sterile water to wash, and centrifuge to remove the supernatant;
[0039] 3. Add 25 μl glass beads (diameter 0.3 mm), 25 μl 1 mg / ml proteinase K, mix well, and incubate at 60°C for 10 minutes;
[0040] 4. Shake at 1200 rpm for 6 minutes in a microplate mixer;
[0041] 5. Add 50 μl of 10% chelex sol...
Embodiment 2
[0044] Example 2 Using commonly used 16s rRNA primers and PCR amplification to identify intestinal flora
[0045] The standard 16s rRNA universal primer forward is 515F: 5'-GTGCCAGCMGCCGCGG-3', reverse: 907R: 5'-CCGTCAATTCMTTTRAGTTT-3'; now a point mutation crossover combination is used to form a 24×16 primer square (Table 1), corresponding to 384 sample combinations, carry out specific amplification; the amplification results show that for the primers with different site mutations, the PCR effect is obvious, and the size is near the target band, and the experimental results are reliable (see figure 2 );
[0046] Table 1. The sequences and numbers of each primer
[0047] Primer name adapter (underline) + universal primer (5'-3', mutations are marked in lowercase) number
[0048] 1B515F1-A CACTCCATACAGCACGCTCTTCCGATCTTCCCGA aTGCCAGCMGCCGCGGD1
[0049] 1B515F1-B CACTCCATACAGCACGCTCTTCCGATCTTCCCGAtTGCCAGCMGCCGCGGD2
[0050] 1B515F1-C CACTCCATACAGCACGCTCTTCCGATCTTCCCGA ...
Embodiment 3
[0109] Example 3 Sequence tag recognition and reduction to each tube
[0110] Use python software to design the sorting program:
[0111] Program flow: assign all sequenced sequence marker sites to corresponding PCR reaction wells >> select 20-30 sequences from each well and integrate them into a single fasta file >> perform stand-alone BLAST sequence comparison >> perform results in excel Classification and Sorting >> Output homologous comparison results to excel; the execution effect is shown in the following table:
[0112] The first column in the table is the hole position, the second column is the maximum 20 sequences randomly taken out, the third column is the largest possible strain, and the fourth column is the sequence of the strain;
[0113] Cell_position Total_count 1Species 1Hit
[0114] 515F1-D-907R1-9 20 Veillonella dispar 8
[0115] 515F1-E-907R1-9 20 Veillonella dispar 7
[0116] 515F1-H-907R1-11 20 Veillonella dispar 4
[0117] 515F1-I-907R1-6 20 Veillo...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More