A recombinant vector for assisting hydrogen production, a recombinant strain and its construction method and application

A technology of recombinant strains and recombinant vectors, which is applied in the field of genetic engineering, can solve problems such as differences in hydrogen production efficiency, low hydrogen gas, and inability to meet human needs for clean energy, and achieve the effect of improving hydrogen production efficiency

Active Publication Date: 2021-09-28
BEIJING UNIV OF TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, wild Escherichia coli does not produce hydrogen or produces little hydrogen, which cannot meet human needs for clean energy. Therefore, genetic engineering methods are used to transform Escherichia coli to greatly improve its hydrogen production performance
The existing hydrogen-producing Escherichia coli consumes a lot of substrates, but produces less hydrogen and has a relatively low efficiency. It is urgent to increase the hydrogen production efficiency by introducing exogenous genes, and the hydrogen production efficiency of different exogenous genes also different

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant vector for assisting hydrogen production, a recombinant strain and its construction method and application
  • A recombinant vector for assisting hydrogen production, a recombinant strain and its construction method and application
  • A recombinant vector for assisting hydrogen production, a recombinant strain and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] (1) Search for the homologous gene sequence of the Bacillus cereus FHL system transcription protein FhlA on NCBI, and then combine the pET32a plasmid sequence, and use DNAMAN software to design the FHL system transcription protein FhlA encoding gene with the vector homologous sequence primers. The designed primers were handed over to Sangon Bioengineering (Shanghai) Co., Ltd. for primer synthesis.

[0048] The designed primers are:

[0049] Forward-Primer:

[0050] AACTTTAAGAAGGAGATATA CATATG TTTCGAGATAATCGTACAAAT

[0051] Reverse-Primer:

[0052] CAGCCGGATCTCAGTGGTGGTGGTGGTGGTG CTCGAG TAATGGTACATTTACTTTTAC

[0053] (2) According to the designed primers, the fhlA gene fragment was amplified by PCR technique. PCR amplification program: denaturation at 94°C for 15s, annealing at 60°C for 10s, extension at 68°C for 2min, 30 cycles; PCR amplification system: 25μL 2×HiFi-PCRMaster, 20μL ddH 2 O, 1 μL DNA template, 2 μL upstream primer (10 μmol / L), 2 μL downstream p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a recombinant vector pET32a-fhlA assisting hydrogen production, a recombinant strain and its construction method and application, belonging to the technical field of genetic engineering. The recombinant vector assisting hydrogen production includes an initial vector and an fhlA gene, and the initial The vector is pET32a vector; the recombinant strain includes the recombinant vector assisting hydrogen production. The recombinant strain can use sodium formate as a substrate to produce hydrogen, and when the final concentration of sodium formate is 60mmol / L, the amount of hydrogen produced is the highest, reaching 9.8mmol H 2 / L / h, the hydrogen production capacity is significantly higher than that of wild bacteria and empty plasmid recombinant bacteria, which can improve the hydrogen production efficiency.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant carrier for assisting hydrogen production, a recombinant bacterial strain and a construction method and application thereof. Background technique [0002] Biohydrogen production has attracted much attention due to its generation of clean and high-heat hydrogen energy. There are many microorganisms for biohydrogen production, among which Escherichia coli hydrogen production is one of the best choices in terms of cost and efficiency. At present, wild Escherichia coli does not produce hydrogen or produces little hydrogen, which cannot meet human needs for clean energy. Therefore, genetic engineering methods are used to transform Escherichia coli to greatly improve its hydrogen production performance. The existing hydrogen-producing Escherichia coli consumes a lot of substrates, but produces less hydrogen and has a relatively low efficiency. It ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/70C12N1/21C12P3/00C12R1/19
CPCC07K14/32C12N15/70C12P3/00
Inventor王海燕刘伟程水源
OwnerBEIJING UNIV OF TECH