PCR primer group and kit for detecting JAK2V617F and CALR ninth exon gene mutation
A technology of JAK2V617F and exons, applied in DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., to achieve high sensitivity and high throughput
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035]A PCR primer set for detecting JAK2 V617F and CALR ninth exon gene mutation, including ARMS primers for JAK2 V617F gene mutation and PCR primers for CALR ninth exon gene mutation; wherein, the ARMS primers for JAK2 V617F gene mutation include JAK2 wild-type forward primer shown in SEQIDNO: 1, JAK2 mutant reverse primer shown in SEQIDNO: 2, JAK2 internal reference forward primer shown in SEQIDNO: 3 and SEQIDNO: The JAK2 internal reference reverse primer shown in 4, the PCR primers for the mutation of the ninth exon of CALR include the CALR forward primer shown in SEQ ID NO: 5 and the CALR reverse primer shown in SEQ ID NO: 6.
[0036] details as follows:
[0037] JAK2 wild-type forward primer: CATGGTTTTAAAATTATGGAGTATATG
[0038] JAK2 mutant reverse primer: GGTCTTACTCTCGTCTCCACAAAA
[0039] JAK2 internal reference forward primer: TCCTCAGAACGTTGATGGCAG
[0040] Internal reference reverse primer for JAK2: TTGCTTTCCTTTTTCACAAGAT
[0041] CALR forward primer: AGGCAGCAGAGA...
Embodiment 2
[0045] A PCR kit for detecting JAK2 V617F and CALR exon 9 gene mutations, containing 10 uL of 2×rTaq PCR reaction solution, JAK2 wild-type forward primer and JAK2 mutant reverse primer described in Example 1 , JAK2 internal reference forward primer, JAK2 internal reference reverse primer, CALR forward primer and CALR reverse primer 0.5uL each, whole blood DNA template 1uL, ddH 2 O 6uL, wherein the concentration of each primer is 10uM.
[0046] Unless otherwise specified, all chemical reagents were purchased from Sigma-Aldrich (St Louis, USA), and molecular biology reagents were purchased from Takara Company (Dalian, China).
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com