Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

PCR primer group and kit for detecting JAK2V617F and CALR ninth exon gene mutation

A technology of JAK2V617F and exons, applied in DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., to achieve high sensitivity and high throughput

Pending Publication Date: 2020-07-31
内蒙古医科大学附属医院
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no related reports at home and abroad that use the fragment analysis function of the genetic analysis system based on capillary electrophoresis technology to simultaneously detect the deletion or insertion mutation of exon 9 of JAK2V617F and CALR.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR primer group and kit for detecting JAK2V617F and CALR ninth exon gene mutation
  • PCR primer group and kit for detecting JAK2V617F and CALR ninth exon gene mutation
  • PCR primer group and kit for detecting JAK2V617F and CALR ninth exon gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035]A PCR primer set for detecting JAK2 V617F and CALR ninth exon gene mutation, including ARMS primers for JAK2 V617F gene mutation and PCR primers for CALR ninth exon gene mutation; wherein, the ARMS primers for JAK2 V617F gene mutation include JAK2 wild-type forward primer shown in SEQIDNO: 1, JAK2 mutant reverse primer shown in SEQIDNO: 2, JAK2 internal reference forward primer shown in SEQIDNO: 3 and SEQIDNO: The JAK2 internal reference reverse primer shown in 4, the PCR primers for the mutation of the ninth exon of CALR include the CALR forward primer shown in SEQ ID NO: 5 and the CALR reverse primer shown in SEQ ID NO: 6.

[0036] details as follows:

[0037] JAK2 wild-type forward primer: CATGGTTTTAAAATTATGGAGTATATG

[0038] JAK2 mutant reverse primer: GGTCTTACTCTCGTCTCCACAAAA

[0039] JAK2 internal reference forward primer: TCCTCAGAACGTTGATGGCAG

[0040] Internal reference reverse primer for JAK2: TTGCTTTCCTTTTTCACAAGAT

[0041] CALR forward primer: AGGCAGCAGAGA...

Embodiment 2

[0045] A PCR kit for detecting JAK2 V617F and CALR exon 9 gene mutations, containing 10 uL of 2×rTaq PCR reaction solution, JAK2 wild-type forward primer and JAK2 mutant reverse primer described in Example 1 , JAK2 internal reference forward primer, JAK2 internal reference reverse primer, CALR forward primer and CALR reverse primer 0.5uL each, whole blood DNA template 1uL, ddH 2 O 6uL, wherein the concentration of each primer is 10uM.

[0046] Unless otherwise specified, all chemical reagents were purchased from Sigma-Aldrich (St Louis, USA), and molecular biology reagents were purchased from Takara Company (Dalian, China).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene detection, and in particular relates to a PCR primer group and kit for detecting JAK2V617F and CALR ninth exon gene mutation. Multiple PCR and a genetic analysis system based on a capillary electrophoresis technology are combined, and JAK2V617F and CALR ninth exon gene mutation detection is completed at the same time in one PCR reaction system.The PCR product fragment analyzed by the capillary electrophoresis fragment analysis method has high resolution, so that the PCR product fragment can be identified even if non-specific amplification occurs, and the traditional means can be interpreted to be positive only when a fluorescence signal occurs at a site with a specific fragment size. The PCR primer group and kit have high sensitivity, and can recognize mutations in DNA minimum to 0.1 ng / [mu]L and mutation of at least 0.1%. The flux is high, and the method can be used for simultaneously analyzing the gene mutation conditions of 96 specimens, and can be applied to large-scale disease screening.

Description

technical field [0001] The invention belongs to the technical field of gene detection, in particular to a PCR primer set and a kit for detecting JAK2 V617F and CALR exon nine gene mutations. Background technique [0002] BCR-ABL negative myeloproliferative neoplasms (myeloproliferative neoplasms, MPN), polycythemia vera (PV), essential thrombocythemia (essential thrombocythemia, ET) and primary myelofibrosis (primary myelofibrosis, PMF) ) and other diseases. Such diseases are mainly caused by mutations in normal human genes, resulting in the active proliferation of one or more lines of bone marrow cells. Therefore, the discovery and detection of gene mutations has become the main diagnostic method for MPN. Recent studies have shown that JAK2 (Janus kinase 2), CALR (calreticulin), MPL (myeloproliferative leukemia virus gene) and other gene mutations mainly exist in MPN patients, and JAK2, CALR, and MPL gene mutations have become the main criteria for the diagnosis of MPN. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6883C12Q1/686C12N15/11
CPCC12Q1/6886C12Q1/6883C12Q1/686C12Q2600/156C12Q2537/143
Inventor 袁建龙韩艳秋师迎旭
Owner 内蒙古医科大学附属医院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products