44 results about "Electrophoresis technique" patented technology

This invention relates to an electrophoresis module in the field of electrophoresis technology, comprising a gantry frame, an immersion tank, and a conveying module. The conveying module includes a fixed frame, a cathode conductive mechanism, and a suspension assembly. The suspension assembly is mounted on the fixed frame via a chain drive assembly, and the cathode conductive mechanism is disposed within the fixed frame. This invention places the cathode conductive mechanism within the fixed frame, and the suspension assembly is electrically connected to the cathode conductive mechanism via conductive springs, avoiding direct exposure of the cathode conductive mechanism to the electrophoresis solution environment, effectively solving the problem of easy corrosion of the cathode conductive mechanism by the electrophoresis solution in existing technologies. Simultaneously, the use of U-shaped insulating blocks to arrange the conductive springs not only prevents the current from the conductive springs from breaking down the slider and other components; moreover, the design of the U-shaped insulating blocks nested on the slider enhances the overall structural stability, preventing components from loosening or falling off due to vibration or external forces during the electrophoresis process.

The present invention relates to a panel structure for a reflective custom color display device on the basis of electrophoresis technology, and a method for controlling same, and more specifically, to a panel structure for a reflective display device and a method for controlling same wherein various colors can easily be implemented by combining electrophoretic particles having unique colors without a complicated manufacturing process, an electrically complicated driving method is not required, and stable color reproducibility can be secured when repeatedly driven.

The invention relates to an electrophoresis ion signal wireless transmission system, and belongs to the technical field of environment monitoring. Comprising a microchip electrophoresis soil ion signal acquisition terminal, a wireless transmission system based on a Zigbee network, and a remote monitoring platform realized based on a Zigbee network group, collecting ion species and concentration characteristic signals in the soil sample, and meanwhile, providing environment parameters with consistent time and space; stable wireless network connection is established through a Zigbee network, so that data transmission is realized; and remote access is supported. According to the electrophoresis ion signal wireless transmission system provided by the invention, precise monitoring of soil ions is realized through a microchip electrophoresis technology, a Zigbee network is adopted, multi-node data relay is supported, stable wireless transmission is ensured, the transmitting power is adaptively adjusted to enhance environmental adaptability, and data processing efficiency is improved through cloud intelligent classification and concentration prediction; and the remote monitoring platform supports real-time data viewing and decision making.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker primer for identifying male and female plants of actinidia valvata and application of the SNP molecular marker primer. The nucleotide sequences of the marker primer are shown as SEQ ID NO. 1 and SEQ ID NO. 2. The primer provided by the invention solves the problem that the male parent and male parent selection time is relatively long in the new variety cultivation and improved hybrid combination configuration process. The method can be used for identifying the sex of the actinidia valvata at the seedling stage; the method can be applied to molecular marker assisted breeding, it can be ensured that stocks with good affinity with scion varieties can be selected through identification, the grafting success rate is increased, the breeding cost is saved, and the stress resistance and adaptability of the scion varieties are improved. By identifying the hybrid combination of different male and female individuals in the early breeding stage, the male and male parent family is constructed, and the method has important significance in improving the grafting advantage and breeding efficiency and shortening the breeding process. Compared with polyacrylamide gel electrophoresis, the electrophoresis technology for detection is rapid, simple and convenient, and is safer to the environment and human bodies.

The invention belongs to the technical field of plant molecular genetics, and particularly discloses an InDel molecular marker for identifying bitter gourd sex and application thereof.The specific InDel molecular marker is screened out by constructing sequencing data of a strong female parent mixed pool P1 (23C37), a strong male parent mixed pool P2 (23C38), F1 and F2 BAS mixed pools and combining bioinformatics analysis, and the molecular marker is used for identifying bitter gourd sex. The excavated InDel molecular marker sites are different from annotation genes of homologous pistil genes reported in cucurbitaceae species in the past, when the InDel molecular marker is used for identifying the strong female characters of the bitter gourds in the seedling stage, detection is easy and convenient, the requirements for instruments, equipment and the technology are low, the detection can be conducted on an electrophoresis technology platform, and the method is suitable for large-scale popularization and application. Sex typing can be completed in the seedling stage (3-4 true leaf stage), and an efficient tool is provided for sex identification of bitter gourds and other cucurbitaceae crops.

The utility model relates to the technical field of electrophoresis, in particular to an electrophoresis tank liquid circulation system which comprises an electrophoresis tank box body and a cleaning mechanism, a rotating pipe is arranged at the bottom end of the electrophoresis tank box, the bottom end of the rotating pipe extends to the outside of the bottom end of the electrophoresis tank box and is connected with a connecting pipe, the other end of the connecting pipe is connected with a filtering mechanism on the side wall of the electrophoresis tank box through a circulating pump, and the cleaning mechanism comprises a sealing plate, a collecting box, a backflow pipe and an air supply pipe. Bubbles generated during electrophoresis of electrolyte in the electrophoresis tank box body are conveniently cleaned through the cleaning mechanism, the bubbles are prevented from interfering with normal electrophoresis work, the electrophoresis quality is improved, the cleaning mechanism can be correspondingly adjusted along with the change of the liquid level of the electrolyte in the electrophoresis tank box body, and the application range is wider.

The utility model provides an electrophoresis assembly line hanger of an electric automobile battery support component, which relates to the technical field of electrophoresis assembly line electrophoresis of the electric automobile battery support component, and comprises a hanging frame, a group of hanger bodies are arranged in the hanging frame, each hanger body comprises a hanging plate, and a group of V-shaped grooves are formed in the upper surface of each hanging plate. The hanger is provided with the hanging frame, the hanger body, the hanging plate, the hooks, the V-shaped grooves, the fastening nuts and the anti-shaking screws, the hanger body is hung on the hanging frame through the hooks, the anti-shaking screws can prevent the hanger body from violently shaking on the hanging frame, workpieces can be hung on the hanger body through the iron wire hooks through the V-shaped grooves, and the workpieces can be hung on the hanger body through the fastening nuts due to the arrangement of the V-shaped grooves. According to the workpiece hanger, the workpieces can be controlled to be neatly arranged on the hooks only by arranging the hooks, operation and management are convenient, the workpieces can be neatly hung on the hanging frame through the reasonable hanger body, and on the premise that the electrophoresis quality requirement is met, the production efficiency is improved to the maximum extent.

The present invention discloses a method for preparing a silver nanowire transparent conductive film using electrophoresis technology, comprising the following steps: Step 1: preparing a silver nanowire suspension; Step 2: treating the silver nanowire suspension obtained in Step 1 using an electrophoretic method to uniformly deposit the silver nanowires on an anode to form a silver nanowire film; Step 3: placing the anode obtained in Step 2 on a transparent substrate and performing hot rolling, and then peeling off the anode after hot rolling to obtain the silver nanowire transparent conductive film. In the present invention, the electrophoretic method can be used to control the sheet resistance and light transmittance of the silver nanowire transparent conductive film, and the hot rolling can significantly enhance the adhesion of the silver nanowire film and reduce its surface roughness.

This invention discloses a method and application for detecting N-glycans based on in-gel enzymatic digestion and electrophoresis. The method includes the following steps: separating glycoprotein samples and cutting target bands by gel electrophoresis; decolorizing and dehydrating the target glycoprotein particles; adding enzyme solution for direct enzymatic release of N-glycans within the gel; transferring the enzyme digestion solution after sonication, drying, and labeling the N-glycan sample; and finally, separating, detecting, and analyzing the N-glycans using capillary electrophoresis. This invention innovatively combines in-gel enzymatic digestion with capillary electrophoresis, avoiding the complex sample transfer and pretreatment steps of traditional methods, significantly simplifying the operation process, reducing sample loss, and making it particularly suitable for the efficient detection of low-abundance N-glycans. This method features high sensitivity, high resolution, and high throughput, and can accurately analyze N-glycans in complex biological samples, with wide applications in disease biomarker screening, clinical diagnosis, and glycomics research.

The application relates to a capillary electrophoresis system and method combined with a non-continuous sample injection mass spectrum, wherein the system comprises: an electrophoretic separation-electrospray ionization module for separating components in a target analyte according to different electrophoretic mobilities; a real-time adjustable high-voltage power supply device for providing a voltage required by capillary electrophoresis according to the requirements of an electroosmotic flow and an electrophoretic speed in a capillary; a target component signal feedback module for detecting a target analyte or a real-time electroosmotic flow speed; an electrophoretic current measurement and migration time correction module; a real-time feedback signal processing and control module; and a non-continuous sample injection mass spectrum system. Thus, the problems in the prior art that, when a continuous capillary electrophoresis technology is combined with a non-continuous sample injection small mass spectrum system, the accuracy is reduced, the analysis quality is poor, the sampling frequency is greatly limited, it is difficult to ensure that mass spectrum data at the highest point of a chromatographic peak can be collected, and the sensitivity of detection and the accuracy of quantitative analysis are affected are solved.

The present invention discloses a primer set for rapid identification of Aesculus hippocastanum germplasm resources using capillary electrophoresis technology and its application. The primer base sequences are shown in SEQ ID NOs. 1-16. This invention enables rapid identification of Aesculus hippocastanum germplasm resources at the molecular level, unaffected by season, plant development period, and growth environment. It also provides reference and support for genetic diversity assessment, phylogenetic relationship analysis, and new variety protection of Aesculus hippocastanum germplasm resources.

The invention relates to the technical field of electrophoresis, and discloses a paint removing device for a conductive cup. The moving part can move relative to the base, and the moving direction of the moving part relative to the base is parallel to a first direction; and the cleaning part is connected with the moving part, and the cleaning part is used for moving along with the conductive cup in the first direction and removing paint on the conductive cup. The paint removing device for the conductive cup can remove paint on the conductive cup in the operation process of the electrophoresis carrier.

The application discloses a DNA fluorescence spectrum crosstalk correction method and system, and aims to solve the fluorescence signal crosstalk problem caused by the multicolor fluorescence parallel electrophoresis technology in genetic analysis. The method obtains the fluorescence signal curves of the first dye and the second dye through a spectrum correction algorithm, collects main peak height and crosstalk part data points, determines the crosstalk proportion and deviation by using a fitting function, and constructs a relationship expression to identify and correct the crosstalk part. The application significantly reduces the crosstalk influence between the fluorescence signals, and ensures the reliability and accuracy of the DNA test results.

The application belongs to the field of molecular biology, and particularly relates to an insertion / deletion molecular marker for identifying wheat resistance to scab and application thereof, wherein the insertion / deletion marker is located on a 2D chromosome of wheat; and a characteristic sequence of the insertion / deletion marker is 21 bp, and a nucleotide sequence is represented by AACGGCAAAGGCAGGAATACA (SEQ ID No. 1). The application uses PCR and electrophoresis technology to perform genotype selection on a wheat scab-regulating gene, so as to provide a marker for molecular marker-assisted breeding of wheat resistance to scab, and has the advantages of good stability, high accuracy and the like.

The invention relates to the technical field of electrophoresis, and discloses an automatic dosing method for an electrophoresis tank, an electrophoresis system and electronic equipment.The method comprises the steps that tank liquid parameters of tank liquid in the electrophoresis tank and technological parameters of an electrophoresis technology are obtained; inputting the bath solution parameters and the process parameters into a pre-constructed dosage prediction model, and predicting to obtain to-be-supplemented dosage; and controlling the automatic dosing equipment to add chemicals into the electrophoresis tank based on the dosage to be supplemented. According to the automatic dosing method, the stability of the film thickness can be improved, the working efficiency and the product quality can be improved, the use cost can be reduced, and the full-flow digital intelligence capability can be improved.

The invention relates to the field of flow battery diaphragms, in particular to a method for continuously preparing a proton exchange membrane for a flow battery based on an electrophoresis technology. The method comprises the following steps: placing a resin solution in an electrophoresis tank, taking a continuous metal base band as an electrode, controlling current and voltage, moving charged anion and cation resin ions towards positive and negative film forming electrodes under the driving of an electric field, enriching on the metal base band, drying, curing, forming a film, and rolling. The proton exchange membrane prepared by utilizing an electrophoresis method can realize continuous production, and has better ion selectivity, mechanical property and conductivity, so that a flow battery has better battery performance, and a new thought is provided for the development of a flow battery diaphragm. The process is simple, and the problems of environmental protection and safety caused by volatilization of a large amount of solvents in a traditional tape casting method are solved.

The invention provides a method for detecting the content of boric acid based on capillary electrophoresis, which is used for analyzing and detecting the content of boric acid in a boric acid sample solution by utilizing the advantages of electrophoresis mobility difference, influence of electroosmotic flow, interaction among separation media and the like of a capillary electrophoresis technology. And the influence of a quality discrimination effect and a memory effect can be effectively eliminated.

This utility model relates to the field of electrophoresis technology and discloses a phosphating device for automotive parts before electrophoresis, comprising: a base frame; a pool body fixedly connected to the top of the base frame; a filter section disposed on the top of the pool body; and a cleaning section disposed inside the pool body. As the filter plate rises, a drive motor, driven by a connecting column, rotates the scraper, keeping it vertical. Due to the inclination of the triangular connecting frame and the filter plate, impurities slide, driving an electric valve to rotate and open the outlet, allowing some impurities to be transported along a trajectory to the inside of the collection box. Then, a cam is rotated; due to the strong blocking effect of the rotating column and one side of the pool body, the rotation angle of the rotating column is stabilized. Subsequently, a brake lever is pulled, causing the transmission plate to slide along the inclined trajectory, thereby driving the scraper to scrape and clean the impurities on the top of the filter plate.

The utility model relates to the technical field of SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis) gel electrophoresis, and discloses a rapid gel preparation device for SDS-PAGE gel electrophoresis, which comprises a mixing pipe and a plurality of material storage pipes, a communication channel is fixedly arranged between the bottoms of the material storage pipes and the mixing pipe, plugging pieces are arranged in the material storage pipes, the plugging pieces are used for plugging the communication channel, and the material storage pipes are connected with the mixing pipe. A jacking part is slidably connected into the mixing pipe, and the jacking part can penetrate through the communicating channel and jack the plugging part upwards when sliding upwards along the inner wall of the mixing pipe, so that the storage pipe communicates with the mixing pipe. A plurality of material storage pipes are fixedly mounted at the top of the mixing pipe, the plugging pieces and the jacking pieces are arranged between the material storage pipes and the mixing pipe, and whether the material storage pipes are communicated with the mixing pipe or not can be controlled through the plugging pieces and the jacking pieces, namely whether raw material liquid is released into the mixing pipe or not to be mixed can be controlled; all the raw material liquid can be conveniently added into the mixing pipe for mixing at one time.

The application provides an automatic electrophoresis device based on a micro-pump valve integrated chip, and belongs to the technical field of capillary electrophoresis. The device comprises an electrophoresis chip and at least one glue filling control unit. The electrophoresis chip has a micro-pump valve unit, which comprises a glue filling plunger and a plunger valve for controlling the opening and closing of a flow path. The glue filling control unit is provided with corresponding plunger driving elements and valve core driving elements. The glue filling control unit can slide relative to the electrophoresis chip, so as to be switched between a first coupling position and a first decoupling position. Through the sliding coupling and decoupling between the driving mechanism and the chip, the application solves the problem that the chip consumables are difficult to replace due to the fixed connection of the driving assembly. Meanwhile, through decoupling avoidance, the spatial interference of the driving mechanism on the sample injection module, the detection module and other modules in different process stages is eliminated, and the overall automation level of the device is improved.

The invention relates to the technical field of single-cell gel electrophoresis, and discloses a single-cell gel electrophoresis first-layer gel spreading method, which comprises the steps of gel solution preparation, vertical impregnation, gradient temperature control solidification, storage and the like. According to the glue spreading method for the first layer of the single-cell gel electrophoresis, the physical performance of the glue layer is further optimized through two-stage temperature control of low-temperature solidification of gradient temperature control solidification and secondary heating stabilization, a 50 ml beaker is adopted as a dissolving container, and the uniformity of the solution volume and temperature diffusion can be ensured; compared with traditional natural cooling for 4 h or above, the total consumed time can be shortened to 2 h, meanwhile, the influence of room temperature fluctuation on the gel forming quality can be avoided, compared with a traditional method, the thickness of a gel layer prepared through the method is more uniform, background noise during electrophoresis can be reduced, the cell fixation success rate is higher, the experiment repetition rate is higher, and the method is suitable for large-scale popularization and application. The sensitivity and the accuracy of DNA damage detection are obviously improved.

The invention discloses a multifunctional molecular biology electrophoresis auxiliary device, and relates to the technical field of molecular biology electrophoresis, and the technical scheme is characterized in that the multifunctional molecular biology electrophoresis auxiliary device comprises an outer groove assembly, a preparation groove assembly is placed in the outer groove assembly, gel sampling comb driving parts are arranged on the two sides of the outer groove assembly, linear up-down driving parts are connected to the gel sampling comb driving parts, and a sampling comb clamping device is arranged between the gel sampling comb driving parts and the linear up-down driving parts. Supporting legs are arranged at the bottom of an outer tank body of the outer tank assembly, and a liftable supporting plate and fine needles are arranged in the outer tank assembly; vibration motors are arranged on the two sides of an inner tank body of the preparation tank assembly. The gel sampling comb driving piece is composed of an electric control linear sliding rail and an electric control sliding block, and the linear up-down driving piece moves up and down through a servo motor, a lead screw and the like. And the sampling comb clamping device can be used for stably clamping the gel sampling comb. According to the device, through cooperation of all parts, air in gel can be exhausted, gel preparation is more uniform, the position of a sampling comb can be controlled, deformation of a sampling nozzle during sampling is avoided, and the efficiency and quality of an electrophoresis experiment are improved.

The utility model relates to the technical field of motorcycle electrophoresis, and particularly discloses a motorcycle frame electrophoresis tank which comprises a tank body and an electrophoresis piece, a liquid adding assembly is arranged on one side of the top of the tank body, the bottom of the tank body is communicated and connected with a liquid discharging pipeline, and the tops of the two sides of the tank body are provided with material passing openings allowing a motorcycle frame to pass through in a hoisting mode. A sludge deposition bottom plate capable of lifting and sliding along the inner side wall of the tank body is mounted at the inner bottom of the tank body, a liquid outlet is formed in the sludge deposition bottom plate, a liquid filtering net is mounted at the top end of the liquid outlet, a liquid discharging control part is arranged between the bottom of the liquid outlet and a liquid discharging pipeline, and an anti-blocking sludge smashing mechanism is arranged on the upper surface of the sludge deposition bottom plate; the anti-blocking mud smashing mechanism comprises a motor, a rotating sleeve, a plurality of mud smashing rods and a mud smashing brush, the rotating sleeve and the motor are both located on one side of the liquid outlet, and the problems that sludge generated in the electrophoresis process of a traditional motorcycle frame easily causes blockage of the liquid outlet in the bottom of an electrophoresis tank, and electrophoresis liquid in the electrophoresis tank is inconvenient to discharge and replace regularly are solved.

The utility model relates to the technical field of wheel electrophoresis, in particular to a wheel electrophoresis air bag eliminating device which comprises an electrophoresis tank, a catenary track, a wheel lifting appliance and an air bubble eliminating device, the catenary track is positioned above the electrophoresis tank, one end of the wheel lifting appliance is hung on the catenary track, and the other end of the wheel lifting appliance is hung on the wheel, so that the wheel is immersed into the electrophoresis tank; the bubble removing device is arranged on the electrophoresis tank; the bubble eliminating device is provided with a tooth-shaped structure, the catenary track drives the wheel to walk along the tooth-shaped structure through the lifting appliance, and then a cavity formed by bubbles between the outer surface and electrophoresis liquid is eliminated. The device has the advantages that the air bag phenomenon in the electrophoresis process is solved through the tooth-shaped structure of the toothed plate, and the device is simple in structure and convenient to maintain and replace.

The invention belongs to the technical field of dairy product detection, and particularly relates to a method for detecting the proportion and activity of each whey protein in milk and dairy products through a fluorescent gel electrophoresis technology. Carrying out lauryl sodium sulfate-polyacrylamide gel electrophoretic analysis on the milk and dairy products marked by the protein fluorescent dye, firstly adding concentration gel for concentration, compressing the protein dispersed in a sample loading hole into a narrow sample band, then adding separation gel for separation, and according to the difference of molecular weights of different whey proteins and casein, determining the content of the whey protein and the casein. According to the method, whey proteins are separated from each other, migration rates in gel are different, effective separation is realized, finally, an electrophoretogram is obtained through a gel imaging system, a gray value of the electrophoretogram is subjected to quantitative processing by adopting gel image analysis software, and the proportion and activity of each whey protein are obtained through calculation. Compared with a traditional Coomassie brilliant blue dyeing method, the method is high in marking speed, does not need time-consuming dyeing and decolorizing steps, and is high in practicability.

The utility model relates to the technical field of vehicle body electrophoresis, and discloses a vehicle body electrophoresis auxiliary anode which comprises a supporting column and an anode main body arranged on one side of the supporting column, a moving mechanism and a dismounting mechanism are arranged on the supporting column and the anode main body, and a motor drives a rotating sleeve to rotate so as to drive a rotating rod to rotate. The rotating rod rotates to drive the fixing block to rotate left and right, the anode body can be driven to rotate left and right through rotation of the fixing block, the output end of the electric telescopic rod drives one end of the rotating plate to rotate upwards, one side of the rotating plate rotates downwards, and then the anode body can be driven to rotate downwards. The anode main body can be rotated and adjusted at multiple angles through the matching of the anode main body and the anode main body, so that the anode main body can be changed at multiple angles while extending into a vehicle body, the use applicability of the equipment is improved, and the electrophoresis uniformity and quality of the vehicle body are ensured.

The invention discloses an electrophoresis production line, relates to the technical field of workpiece electrophoresis, and aims to solve the technical problem that after an existing electrophoresis production line breaks down, workpieces in an electrophoresis tank are retained or drained in a suspended mode, and a large number of waste products are generated. The electrophoresis production line comprises a production line track, a plurality of workpiece conveying pieces, a plurality of processing stations, a trigger module and a control device, the workpiece conveying pieces are connected with the production line track, and the workpiece conveying pieces are connected with a driving assembly and a connecting assembly; the plurality of processing stations are arranged below the production line track, one processing station is provided with a washing tank, and the other processing station is provided with an electrophoresis tank; the trigger module is arranged on the production line track, and a first temporary storage station is arranged between the trigger module and the rinsing bath; and the control device is electrically connected with the trigger module and the driving assembly of each workpiece conveying piece. Based on the electrophoresis production line provided by the invention, after a fault occurs, the electrophoresis tank can be vacated for washing the workpiece, so that the problems of poor workpiece quality and waste generation caused by the fact that the workpiece after electrophoresis cannot be washed are solved.

The invention relates to the technical field of heating radiator electroplating and electrophoresis, and particularly discloses a steel plate type heating radiator electroplating and electrophoresis process which comprises a pretreatment process, an electroplating process, an electrophoretic coating process, an intelligent temperature control curing process and a full-process intelligent monitoring system. And the compactness, the corrosion resistance and the self-repairing capability of the plating layer are obviously improved.

The invention belongs to the technical field of amino acid detection and analysis, and provides a rapid analysis method for amino acid, which efficiently completes derivatization of amino acid and fluorescein isothiocyanate in a short time by utilizing a microwave-assisted reaction, and remarkably shortens the traditional time-consuming and tedious pretreatment time. A capillary electrophoresis technology is adopted, derivatized amino acid is separated under constant voltage, and by monitoring voltage and current signals in the electrophoresis process in real time, the migration charge density independent of single migration time is calculated to serve as a qualitative criterion. The separated components are subjected to high-sensitivity detection through a diaphragm coupled laser-induced fluorescence system. Finally, qualitative and quantitative analysis is performed in combination with migration time and migration charge density, and identification of various common amino acids can be realized without a standard substance. According to the invention, full-process automation from sample introduction to result output is realized, the analysis speed is high, the sample consumption is low, and the reproducibility is high.

This invention relates to the field of electrophoresis technology, specifically disclosing an electrophoretic paint coating equipment for automobile production. The equipment includes an electrophoresis tank body with a support frame mounted above it, a paint liquid isolation component disposed inside the electrophoresis tank body, a material conveying component disposed below the support frame for material conveying, and a circulation component disposed outside the electrophoresis tank body. The paint liquid isolation component includes a first conveyor wheel and a second conveyor wheel. In this invention, by setting up the paint liquid isolation component, the movement direction of the material inside the electrophoresis tank body is blocked, reducing contact between impurities and the material. Simultaneously, the paint liquid isolation component can directly introduce the filtered electrophoretic liquid to the vicinity of the material, replenishing the electrophoretic liquid near the material and preventing a decrease in the concentration of the electrophoretic liquid near the material, thereby improving the quality of the electrophoretic coating.