78 results about "Electrophoresis technique" patented technology

The invention discloses a high-throughput composite STR (short tandem repeat) detection system based on next-generation sequencing. The high-throughput composite STR detection system comprises specific primer sequences designed for 291 STR loci; the 291 STR loci are composed of 106 autosome STR loci, one sex identification locus Amelogenin, 148 Y chromosome STR loci and 36 X chromosome STR loci, and the 291 STR loci are composed of 106 autosome STR loci, one sex identification locus Amelogenin, 148 Y chromosome STR loci and 36 X chromosome STR loci; the system is used for performing STR typing and is prepared into a kit for individual recognition, paternity identification and complex sample analysis. The STR detection system covers STR locus combinations of whole chromosomes (autosomes and X / Y chromosomes), breaks through the split design in the prior art, can overcome the limitation of the traditional capillary electrophoresis (CE) technology on complex samples, degraded samples and large-scale detection, improves the detection sensitivity, flux and accuracy, and has a good application prospect. And the requirements of identity identification of complex genetic relationships, mixed samples and disastrous events in judicial expertise are met.

The invention discloses a hydrogen peroxide sensing electrode, a preparation method thereof, a hydrogen peroxide electrochemical sensor and a monitoring method. The hydrogen peroxide sensing electrode comprises a tube body, the tube body is provided with a first end and a second end, the first end is provided with a first opening, the second end is a tip, the tip is provided with a second opening, the first opening is communicated with the second opening, and the caliber of the second opening is smaller than that of the first opening; the tip is filled with solid hydrogel embedded with catalase, and the aperture of the solid hydrogel is 20-50 nm; the tube body is filled with an electrolyte, and the electrolyte is a solution with ionic conductivity; the electrolyte is in contact with the solid hydrogel. According to the invention, nano confinement hydrogel and electrophoresis-like technologies are combined, oxygen nano bubbles are used as a signal transduction mechanism, ultrasensitive detection of intracellular H2O2 is realized through ionization sensing, and dynamic change of intracellular hydrogen peroxide can be monitored in situ in real time.

The present invention relates to the technical field of electrophoretic coating of automobile parts, and specifically to an electrophoretic coating tank for automobile parts, comprising a coating tank body with an open top and a sealing cover fixed to the top of the coating tank body by screws, feed slots and discharge slots are correspondingly provided on both sides of the coating tank body, and workbenches are fixed at the feed slots and discharge slots on both sides of the coating tank body, a servo motor is fixed to the middle of the rear end face of the coating tank body, a coating assembly for automatic assembly line coating of parts is rotatably connected inside the coating tank body, wherein the coating assembly is transmission-connected to the servo motor; the coating assembly comprises two fixing rings symmetrically distributed front and back, and the present application can realize automatic assembly line coating of parts by designing the coating tank body and the coating assembly, and for parts that cannot use hangers, such as slat-type parts, the device of the present application has higher automated electrophoretic processing efficiency for such parts, thereby improving the electrophoretic processing quality.

The present invention relates to a panel structure for a reflective custom color display device based on an electrophoresis technology and a method for controlling the same, and more particularly, to a panel structure for a reflective display device and a method for controlling the same, according to the present invention, various colors can be easily realized by combining electrophoretic particles having unique colors without a complicated manufacturing process, an electrically complicated driving method is not required, and stable color reproducibility can be ensured when driving repeatedly.

The invention relates to the technical field of electrophoresis, and provides an electrophoresis piece spray degreasing process which comprises the following steps: a first cleaning procedure: carrying out first cleaning treatment on a to-be-cleaned electrophoresis piece so as to clean off part of impurities on the surface of the electrophoresis piece; a first degreasing process: spraying an alkaline degreasing agent to the surface of the electrophoresis part subjected to the first cleaning process to perform first degreasing treatment so as to remove part of grease; a second degreasing process: enabling a solution containing bio-enzyme to form atomized liquid, and enabling the atomized liquid to be in contact with the surface of the electrophoresis part subjected to the first degreasing process for second degreasing treatment so as to remove residual grease; a second cleaning process: carrying out second cleaning treatment on the electrophoresis piece subjected to the second degreasing process so as to clean away residual impurities on the surface of the electrophoresis piece; the process disclosed by the invention has a good degreasing effect and is beneficial to forming a good coating.

The invention discloses a swinging mechanism for an electrophoresis soaking device, a swinging method and the electrophoresis soaking device, and relates to the technical field of electrophoresis. The swing mechanism for the electrophoresis soaking device comprises a supporting frame, at least one swing assembly and a driving assembly, the at least one swing assembly comprises a plurality of swing rods and a first matching frame, a plurality of matching seats are arranged on the first matching frame at intervals, and each matching seat is provided with a matching surface; the multiple swing rods correspond to the multiple matching faces one to one, one ends of the multiple swing rods are connected with the supporting frame, the other ends of the multiple swing rods are movable ends, and the movable ends abut against the corresponding matching faces and are movably arranged in the inclination directions of the matching faces. According to the swinging mechanism, the movable ends of the multiple swinging rods on the swinging mechanism can reciprocate on the corresponding matching surfaces, so that the hanging bracket can swing in the soaking tank in a reciprocating manner, the flowability of a treatment solution is improved, and the surface treatment quality of a product is improved.

This invention relates to an electrophoresis module in the field of electrophoresis technology, comprising a gantry frame, an immersion tank, and a conveying module. The conveying module includes a fixed frame, a cathode conductive mechanism, and a suspension assembly. The suspension assembly is mounted on the fixed frame via a chain drive assembly, and the cathode conductive mechanism is disposed within the fixed frame. This invention places the cathode conductive mechanism within the fixed frame, and the suspension assembly is electrically connected to the cathode conductive mechanism via conductive springs, avoiding direct exposure of the cathode conductive mechanism to the electrophoresis solution environment, effectively solving the problem of easy corrosion of the cathode conductive mechanism by the electrophoresis solution in existing technologies. Simultaneously, the use of U-shaped insulating blocks to arrange the conductive springs not only prevents the current from the conductive springs from breaking down the slider and other components; moreover, the design of the U-shaped insulating blocks nested on the slider enhances the overall structural stability, preventing components from loosening or falling off due to vibration or external forces during the electrophoresis process.

The present invention relates to a panel structure for a reflective custom color display device on the basis of electrophoresis technology, and a method for controlling same, and more specifically, to a panel structure for a reflective display device and a method for controlling same wherein various colors can easily be implemented by combining electrophoretic particles having unique colors without a complicated manufacturing process, an electrically complicated driving method is not required, and stable color reproducibility can be secured when repeatedly driven.

The utility model relates to the technical field of electrophoresis, in particular to an electrophoresis charging port tool structure which comprises a frame, two first fixing rods, two transverse rods, a supporting plate, four hooks and a limiting assembly, the frame is arranged in a rectangular shape, the supporting plate is arranged above the frame, the two transverse rods are fixedly connected with the supporting plate and located below the supporting plate, and the four hooks are arranged on the frame. The four hooks are fixedly connected with the two corresponding transverse rods respectively and located at one ends of the corresponding transverse rods, one ends of the two first fixing rods are fixedly connected with the frame, the other ends of the two first fixing rods are fixedly connected with the corresponding transverse rods, and the limiting assembly is arranged above the supporting plate. A charging port and a vehicle body are processed by a single electrophoresis processing method, but components are changed after long-term use of electrophoresis liquid, so that the colors of the surfaces of the vehicle body and the charging port are different, and the attractiveness is influenced.

The invention relates to an electrophoresis ion signal wireless transmission system, and belongs to the technical field of environment monitoring. Comprising a microchip electrophoresis soil ion signal acquisition terminal, a wireless transmission system based on a Zigbee network, and a remote monitoring platform realized based on a Zigbee network group, collecting ion species and concentration characteristic signals in the soil sample, and meanwhile, providing environment parameters with consistent time and space; stable wireless network connection is established through a Zigbee network, so that data transmission is realized; and remote access is supported. According to the electrophoresis ion signal wireless transmission system provided by the invention, precise monitoring of soil ions is realized through a microchip electrophoresis technology, a Zigbee network is adopted, multi-node data relay is supported, stable wireless transmission is ensured, the transmitting power is adaptively adjusted to enhance environmental adaptability, and data processing efficiency is improved through cloud intelligent classification and concentration prediction; and the remote monitoring platform supports real-time data viewing and decision making.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker primer for identifying male and female plants of actinidia valvata and application of the SNP molecular marker primer. The nucleotide sequences of the marker primer are shown as SEQ ID NO. 1 and SEQ ID NO. 2. The primer provided by the invention solves the problem that the male parent and male parent selection time is relatively long in the new variety cultivation and improved hybrid combination configuration process. The method can be used for identifying the sex of the actinidia valvata at the seedling stage; the method can be applied to molecular marker assisted breeding, it can be ensured that stocks with good affinity with scion varieties can be selected through identification, the grafting success rate is increased, the breeding cost is saved, and the stress resistance and adaptability of the scion varieties are improved. By identifying the hybrid combination of different male and female individuals in the early breeding stage, the male and male parent family is constructed, and the method has important significance in improving the grafting advantage and breeding efficiency and shortening the breeding process. Compared with polyacrylamide gel electrophoresis, the electrophoresis technology for detection is rapid, simple and convenient, and is safer to the environment and human bodies.

The invention belongs to the technical field of plant molecular genetics, and particularly discloses an InDel molecular marker for identifying bitter gourd sex and application thereof.The specific InDel molecular marker is screened out by constructing sequencing data of a strong female parent mixed pool P1 (23C37), a strong male parent mixed pool P2 (23C38), F1 and F2 BAS mixed pools and combining bioinformatics analysis, and the molecular marker is used for identifying bitter gourd sex. The excavated InDel molecular marker sites are different from annotation genes of homologous pistil genes reported in cucurbitaceae species in the past, when the InDel molecular marker is used for identifying the strong female characters of the bitter gourds in the seedling stage, detection is easy and convenient, the requirements for instruments, equipment and the technology are low, the detection can be conducted on an electrophoresis technology platform, and the method is suitable for large-scale popularization and application. Sex typing can be completed in the seedling stage (3-4 true leaf stage), and an efficient tool is provided for sex identification of bitter gourds and other cucurbitaceae crops.

The utility model relates to the technical field of electrophoresis, in particular to an electrophoresis tank liquid circulation system which comprises an electrophoresis tank box body and a cleaning mechanism, a rotating pipe is arranged at the bottom end of the electrophoresis tank box, the bottom end of the rotating pipe extends to the outside of the bottom end of the electrophoresis tank box and is connected with a connecting pipe, the other end of the connecting pipe is connected with a filtering mechanism on the side wall of the electrophoresis tank box through a circulating pump, and the cleaning mechanism comprises a sealing plate, a collecting box, a backflow pipe and an air supply pipe. Bubbles generated during electrophoresis of electrolyte in the electrophoresis tank box body are conveniently cleaned through the cleaning mechanism, the bubbles are prevented from interfering with normal electrophoresis work, the electrophoresis quality is improved, the cleaning mechanism can be correspondingly adjusted along with the change of the liquid level of the electrolyte in the electrophoresis tank box body, and the application range is wider.

The utility model provides an electrophoresis assembly line hanger of an electric automobile battery support component, which relates to the technical field of electrophoresis assembly line electrophoresis of the electric automobile battery support component, and comprises a hanging frame, a group of hanger bodies are arranged in the hanging frame, each hanger body comprises a hanging plate, and a group of V-shaped grooves are formed in the upper surface of each hanging plate. The hanger is provided with the hanging frame, the hanger body, the hanging plate, the hooks, the V-shaped grooves, the fastening nuts and the anti-shaking screws, the hanger body is hung on the hanging frame through the hooks, the anti-shaking screws can prevent the hanger body from violently shaking on the hanging frame, workpieces can be hung on the hanger body through the iron wire hooks through the V-shaped grooves, and the workpieces can be hung on the hanger body through the fastening nuts due to the arrangement of the V-shaped grooves. According to the workpiece hanger, the workpieces can be controlled to be neatly arranged on the hooks only by arranging the hooks, operation and management are convenient, the workpieces can be neatly hung on the hanging frame through the reasonable hanger body, and on the premise that the electrophoresis quality requirement is met, the production efficiency is improved to the maximum extent.

The present invention discloses a method for preparing a silver nanowire transparent conductive film using electrophoresis technology, comprising the following steps: Step 1: preparing a silver nanowire suspension; Step 2: treating the silver nanowire suspension obtained in Step 1 using an electrophoretic method to uniformly deposit the silver nanowires on an anode to form a silver nanowire film; Step 3: placing the anode obtained in Step 2 on a transparent substrate and performing hot rolling, and then peeling off the anode after hot rolling to obtain the silver nanowire transparent conductive film. In the present invention, the electrophoretic method can be used to control the sheet resistance and light transmittance of the silver nanowire transparent conductive film, and the hot rolling can significantly enhance the adhesion of the silver nanowire film and reduce its surface roughness.

The present invention discloses a molecular marker for rapidly and efficiently identifying tea plants with purple leaf color variation and its application, belonging to the technical field of tea germplasm identification. The sequence of the molecular marker is as shown in SEQ ID No.1, and 2 pairs of primers are designed for this DNA molecular marker, and their sequences are as shown in SEQ ID No.2-5. Beneficial effects: The present invention proposes a method for identifying the leaf color of tea plants, which is a method for identifying whether the purple trait of tea plants is a stable inheritance by using trace DNA extracted from tea plant tissues as a template, molecular marker primer amplification and agarose electrophoresis technology. According to 2 pairs of molecular marker primers, the PCR amplification technology is used to amplify the target band, and whether the tea plant is a heritable purple variety is distinguished according to the position of the target band. The present invention has high reference value for the identification of purple leaf color variation tea plants in natural populations and hybrid populations, and is suitable for popularization and application.

The invention provides a capillary electrophoresis purity detection method of pegylated recombinant human erythropoietin, which comprises the following steps: (1) carrying out N sugar removal treatment on pegylated recombinant human erythropoietin to be detected by using PNGase F enzyme to obtain PEG-EPO after N sugar removal; (2) adding SDS (Sodium Dodecyl Sulfate) to carry out incubation denaturation on the PEG-EPO subjected to N sugar removal; and (3) carrying out capillary gel electrophoresis, and calculating the purity of the sample to be detected according to the peak area ratio of different components. The method solves the problems that a traditional SDS-PAGE method is poor in quantitative accuracy, and when the purity of the medicine is measured through a capillary electrophoresis technology, the number of peaks is large, the peak pattern is deformed, principal components and impurities cannot be effectively separated, and then quantification cannot be achieved, and the accuracy and reliability of purity measurement are guaranteed. The method disclosed by the invention has the characteristics of higher specificity, more accurate quantification and suitability for popularization and application.

This invention discloses a method and application for detecting N-glycans based on in-gel enzymatic digestion and electrophoresis. The method includes the following steps: separating glycoprotein samples and cutting target bands by gel electrophoresis; decolorizing and dehydrating the target glycoprotein particles; adding enzyme solution for direct enzymatic release of N-glycans within the gel; transferring the enzyme digestion solution after sonication, drying, and labeling the N-glycan sample; and finally, separating, detecting, and analyzing the N-glycans using capillary electrophoresis. This invention innovatively combines in-gel enzymatic digestion with capillary electrophoresis, avoiding the complex sample transfer and pretreatment steps of traditional methods, significantly simplifying the operation process, reducing sample loss, and making it particularly suitable for the efficient detection of low-abundance N-glycans. This method features high sensitivity, high resolution, and high throughput, and can accurately analyze N-glycans in complex biological samples, with wide applications in disease biomarker screening, clinical diagnosis, and glycomics research.

The invention relates to the technical field of electrophoresis, in particular to a coating method of an electrophoresis piece. The coating method of the electrophoresis piece comprises a mixing procedure, wherein a zirconium agent, borate and a complexing agent are mixed according to the ratio of (2-6): (1-4): 1, and zirconium-based conversion liquid is obtained; and a zirconium treatment process: soaking the electrophoresis piece into a zirconium-based conversion solution so as to form a zirconium film on the surface of the electrophoresis piece. According to the film coating method, a zirconium agent, borate and a complexing agent are mixed according to the mass ratio of (2-6): (1-4): 1 to obtain a zirconium-based conversion solution, then an electrophoresis piece is soaked in the zirconium-based conversion solution, a zirconium film of a compact structure is formed on the surface of the electrophoresis piece, the addition of borate can contribute to film forming and can also increase the compactness of the film, and the surface of the electrophoresis piece is coated with the zirconium film. In this way, the adhesion force between the zirconium film and the surface of the electrophoresis piece is high, the situation that the zirconium film falls off is reduced, and therefore the anti-corrosion performance and the wear-resisting performance of the electrophoresis piece can be enhanced through the zirconium film.

The application relates to a capillary electrophoresis system and method combined with a non-continuous sample injection mass spectrum, wherein the system comprises: an electrophoretic separation-electrospray ionization module for separating components in a target analyte according to different electrophoretic mobilities; a real-time adjustable high-voltage power supply device for providing a voltage required by capillary electrophoresis according to the requirements of an electroosmotic flow and an electrophoretic speed in a capillary; a target component signal feedback module for detecting a target analyte or a real-time electroosmotic flow speed; an electrophoretic current measurement and migration time correction module; a real-time feedback signal processing and control module; and a non-continuous sample injection mass spectrum system. Thus, the problems in the prior art that, when a continuous capillary electrophoresis technology is combined with a non-continuous sample injection small mass spectrum system, the accuracy is reduced, the analysis quality is poor, the sampling frequency is greatly limited, it is difficult to ensure that mass spectrum data at the highest point of a chromatographic peak can be collected, and the sensitivity of detection and the accuracy of quantitative analysis are affected are solved.

The present invention discloses a primer set for rapid identification of Aesculus hippocastanum germplasm resources using capillary electrophoresis technology and its application. The primer base sequences are shown in SEQ ID NOs. 1-16. This invention enables rapid identification of Aesculus hippocastanum germplasm resources at the molecular level, unaffected by season, plant development period, and growth environment. It also provides reference and support for genetic diversity assessment, phylogenetic relationship analysis, and new variety protection of Aesculus hippocastanum germplasm resources.

The invention relates to the technical field of electrophoresis, and discloses a paint removing device for a conductive cup. The moving part can move relative to the base, and the moving direction of the moving part relative to the base is parallel to a first direction; and the cleaning part is connected with the moving part, and the cleaning part is used for moving along with the conductive cup in the first direction and removing paint on the conductive cup. The paint removing device for the conductive cup can remove paint on the conductive cup in the operation process of the electrophoresis carrier.

The application discloses a DNA fluorescence spectrum crosstalk correction method and system, and aims to solve the fluorescence signal crosstalk problem caused by the multicolor fluorescence parallel electrophoresis technology in genetic analysis. The method obtains the fluorescence signal curves of the first dye and the second dye through a spectrum correction algorithm, collects main peak height and crosstalk part data points, determines the crosstalk proportion and deviation by using a fitting function, and constructs a relationship expression to identify and correct the crosstalk part. The application significantly reduces the crosstalk influence between the fluorescence signals, and ensures the reliability and accuracy of the DNA test results.

The application belongs to the field of molecular biology, and particularly relates to an insertion / deletion molecular marker for identifying wheat resistance to scab and application thereof, wherein the insertion / deletion marker is located on a 2D chromosome of wheat; and a characteristic sequence of the insertion / deletion marker is 21 bp, and a nucleotide sequence is represented by AACGGCAAAGGCAGGAATACA (SEQ ID No. 1). The application uses PCR and electrophoresis technology to perform genotype selection on a wheat scab-regulating gene, so as to provide a marker for molecular marker-assisted breeding of wheat resistance to scab, and has the advantages of good stability, high accuracy and the like.

The invention relates to the technical field of electrophoresis, and discloses an automatic dosing method for an electrophoresis tank, an electrophoresis system and electronic equipment.The method comprises the steps that tank liquid parameters of tank liquid in the electrophoresis tank and technological parameters of an electrophoresis technology are obtained; inputting the bath solution parameters and the process parameters into a pre-constructed dosage prediction model, and predicting to obtain to-be-supplemented dosage; and controlling the automatic dosing equipment to add chemicals into the electrophoresis tank based on the dosage to be supplemented. According to the automatic dosing method, the stability of the film thickness can be improved, the working efficiency and the product quality can be improved, the use cost can be reduced, and the full-flow digital intelligence capability can be improved.

The invention relates to a kit for detecting heart potassium ion channel coding gene idiopathic ventricular fibrillation risk gene SNP (Single Nucleotide Polymorphism) loci, which comprises 38 pairs of specific multiplex PCR (Polymerase Chain Reaction) primer pairs with 41 required SNP loci, 41 SNP single-base extension primers, and necessary PCR reaction liquid, SNaPshot reaction liquid, shrimp alkaline phosphatase and exonuclease I. The kit is used for detecting heart potassium ion channel coding gene idiopathic ventricular fibrillation risk gene SNP loci. According to the kit, the multiple PCR technology, the SNaPshot micro-sequencing technology and the capillary electrophoresis technology are combined to screen the risk gene SNP sites related to the idiopathic ventricular fibrillation on the heart potassium ion channel coding genes, the SNP related to the idiopathic ventricular fibrillation on 41 potassium ion channel genes can be detected only through one experiment, a clear conclusion can be obtained, and result interpretation is simple and objective.

The utility model belongs to the technical field of capillary electrophoresis, and discloses a capillary electrophoresis apparatus capable of efficiently analyzing the size of a nucleic acid fragment, which comprises an electrophoresis apparatus body, a partition plate attached to the inside of the electrophoresis apparatus body, a sliding rod fixedly connected to the top end of the partition plate, a sliding block sleeved on the outer side of the sliding rod, and a round hole groove arranged on the rear side of the sliding block, a screwing block is slidably connected into the circular hole groove of the sliding block, a sliding rod is slidably connected to the center of the interior of the sliding block, the right side of the screwing block abuts against the outer side of the sliding rod, a supporting frame is fixedly connected to the front end of the sliding block, a rotating ring is sleeved with the supporting frame, and a detector is fixedly connected to the top end of the rotating ring; by means of the scheme, the capillary electrophoresis apparatus solves the problems that an existing capillary electrophoresis apparatus can only meet basic detection requirements and cannot gradually meet various specific requirements of the current biotechnology, especially the requirements for miniaturization, integration and convenience.

The invention discloses a wheat scab resistance QTL molecular marker and application thereof, SNP molecular markers are located at 524bp, 519bp and 822bp of a wheat 2D chromosome long arm, and SNP allelic variation is C / T. The gibberellic disease-resistant QTL detection molecular marker can distinguish favorable and unfavorable allelic variations through genotypes, and can save a large amount of manpower, material resources and time for breeding of gibberellic disease-resistant wheat varieties. According to the enzyme digestion amplification polymorphic sequence marker for detecting the wheat gibberellic disease-resistant QTL locus, PCR, restriction enzyme and electrophoresis technologies are utilized to select SNP allelic variation genotypes associated with the wheat gibberellic disease-resistant QTL so as to achieve the purpose of selecting and breeding a gibberellic disease-resistant variety under the assistance of a molecular marker. The marker can show stable and clear stripes in a breeding population composed of 469 natural varieties, and has the advantages of good stability, high accuracy and the like.

The invention provides a separation and purification method of polypeptide for preventing cardiovascular and cerebrovascular diseases, and relates to the technical field of prevention of cardiovascular and cerebrovascular diseases, the separation and purification method comprises a microbial fermentation link, crude separation, purification and refinement, and purity identification and quality control, the microbial fermentation link comprises strain screening and transformation, fermentation condition optimization and fermentation product harvesting, the crude separation comprises a precipitation method and an extraction method, the purification and refining comprises chromatographic separation and an electrophoresis technology, high performance liquid chromatography is adopted for purity identification and quality control, the fermentation condition optimization comprises culture medium optimization and fermentation process control, and the fermentation product harvesting comprises intracellular expression of polypeptide and extracellular secretion of polypeptide. The method has the advantages that separation is carried out step by step according to molecular weight and charge characteristics, chromatographic methods complement each other in advantages, the resolution ratio is high and mild, and the polypeptide purity can be remarkably improved. The polypeptide extracted by the purification method can be used as a raw material for preventing or treating cardiovascular and cerebrovascular diseases.

The invention relates to the field of flow battery diaphragms, in particular to a method for continuously preparing a proton exchange membrane for a flow battery based on an electrophoresis technology. The method comprises the following steps: placing a resin solution in an electrophoresis tank, taking a continuous metal base band as an electrode, controlling current and voltage, moving charged anion and cation resin ions towards positive and negative film forming electrodes under the driving of an electric field, enriching on the metal base band, drying, curing, forming a film, and rolling. The proton exchange membrane prepared by utilizing an electrophoresis method can realize continuous production, and has better ion selectivity, mechanical property and conductivity, so that a flow battery has better battery performance, and a new thought is provided for the development of a flow battery diaphragm. The process is simple, and the problems of environmental protection and safety caused by volatilization of a large amount of solvents in a traditional tape casting method are solved.