29 results about "Electrophoresis technique" patented technology

This invention relates to an electrophoresis module in the field of electrophoresis technology, comprising a gantry frame, an immersion tank, and a conveying module. The conveying module includes a fixed frame, a cathode conductive mechanism, and a suspension assembly. The suspension assembly is mounted on the fixed frame via a chain drive assembly, and the cathode conductive mechanism is disposed within the fixed frame. This invention places the cathode conductive mechanism within the fixed frame, and the suspension assembly is electrically connected to the cathode conductive mechanism via conductive springs, avoiding direct exposure of the cathode conductive mechanism to the electrophoresis solution environment, effectively solving the problem of easy corrosion of the cathode conductive mechanism by the electrophoresis solution in existing technologies. Simultaneously, the use of U-shaped insulating blocks to arrange the conductive springs not only prevents the current from the conductive springs from breaking down the slider and other components; moreover, the design of the U-shaped insulating blocks nested on the slider enhances the overall structural stability, preventing components from loosening or falling off due to vibration or external forces during the electrophoresis process.

The present invention relates to a panel structure for a reflective custom color display device on the basis of electrophoresis technology, and a method for controlling same, and more specifically, to a panel structure for a reflective display device and a method for controlling same wherein various colors can easily be implemented by combining electrophoretic particles having unique colors without a complicated manufacturing process, an electrically complicated driving method is not required, and stable color reproducibility can be secured when repeatedly driven.

The invention relates to an electrophoresis ion signal wireless transmission system, and belongs to the technical field of environment monitoring. Comprising a microchip electrophoresis soil ion signal acquisition terminal, a wireless transmission system based on a Zigbee network, and a remote monitoring platform realized based on a Zigbee network group, collecting ion species and concentration characteristic signals in the soil sample, and meanwhile, providing environment parameters with consistent time and space; stable wireless network connection is established through a Zigbee network, so that data transmission is realized; and remote access is supported. According to the electrophoresis ion signal wireless transmission system provided by the invention, precise monitoring of soil ions is realized through a microchip electrophoresis technology, a Zigbee network is adopted, multi-node data relay is supported, stable wireless transmission is ensured, the transmitting power is adaptively adjusted to enhance environmental adaptability, and data processing efficiency is improved through cloud intelligent classification and concentration prediction; and the remote monitoring platform supports real-time data viewing and decision making.

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker primer for identifying male and female plants of actinidia valvata and application of the SNP molecular marker primer. The nucleotide sequences of the marker primer are shown as SEQ ID NO. 1 and SEQ ID NO. 2. The primer provided by the invention solves the problem that the male parent and male parent selection time is relatively long in the new variety cultivation and improved hybrid combination configuration process. The method can be used for identifying the sex of the actinidia valvata at the seedling stage; the method can be applied to molecular marker assisted breeding, it can be ensured that stocks with good affinity with scion varieties can be selected through identification, the grafting success rate is increased, the breeding cost is saved, and the stress resistance and adaptability of the scion varieties are improved. By identifying the hybrid combination of different male and female individuals in the early breeding stage, the male and male parent family is constructed, and the method has important significance in improving the grafting advantage and breeding efficiency and shortening the breeding process. Compared with polyacrylamide gel electrophoresis, the electrophoresis technology for detection is rapid, simple and convenient, and is safer to the environment and human bodies.

The utility model relates to the technical field of electrophoresis, in particular to an electrophoresis tank liquid circulation system which comprises an electrophoresis tank box body and a cleaning mechanism, a rotating pipe is arranged at the bottom end of the electrophoresis tank box, the bottom end of the rotating pipe extends to the outside of the bottom end of the electrophoresis tank box and is connected with a connecting pipe, the other end of the connecting pipe is connected with a filtering mechanism on the side wall of the electrophoresis tank box through a circulating pump, and the cleaning mechanism comprises a sealing plate, a collecting box, a backflow pipe and an air supply pipe. Bubbles generated during electrophoresis of electrolyte in the electrophoresis tank box body are conveniently cleaned through the cleaning mechanism, the bubbles are prevented from interfering with normal electrophoresis work, the electrophoresis quality is improved, the cleaning mechanism can be correspondingly adjusted along with the change of the liquid level of the electrolyte in the electrophoresis tank box body, and the application range is wider.

The utility model provides an electrophoresis assembly line hanger of an electric automobile battery support component, which relates to the technical field of electrophoresis assembly line electrophoresis of the electric automobile battery support component, and comprises a hanging frame, a group of hanger bodies are arranged in the hanging frame, each hanger body comprises a hanging plate, and a group of V-shaped grooves are formed in the upper surface of each hanging plate. The hanger is provided with the hanging frame, the hanger body, the hanging plate, the hooks, the V-shaped grooves, the fastening nuts and the anti-shaking screws, the hanger body is hung on the hanging frame through the hooks, the anti-shaking screws can prevent the hanger body from violently shaking on the hanging frame, workpieces can be hung on the hanger body through the iron wire hooks through the V-shaped grooves, and the workpieces can be hung on the hanger body through the fastening nuts due to the arrangement of the V-shaped grooves. According to the workpiece hanger, the workpieces can be controlled to be neatly arranged on the hooks only by arranging the hooks, operation and management are convenient, the workpieces can be neatly hung on the hanging frame through the reasonable hanger body, and on the premise that the electrophoresis quality requirement is met, the production efficiency is improved to the maximum extent.

The application relates to a capillary electrophoresis system and method combined with a non-continuous sample injection mass spectrum, wherein the system comprises: an electrophoretic separation-electrospray ionization module for separating components in a target analyte according to different electrophoretic mobilities; a real-time adjustable high-voltage power supply device for providing a voltage required by capillary electrophoresis according to the requirements of an electroosmotic flow and an electrophoretic speed in a capillary; a target component signal feedback module for detecting a target analyte or a real-time electroosmotic flow speed; an electrophoretic current measurement and migration time correction module; a real-time feedback signal processing and control module; and a non-continuous sample injection mass spectrum system. Thus, the problems in the prior art that, when a continuous capillary electrophoresis technology is combined with a non-continuous sample injection small mass spectrum system, the accuracy is reduced, the analysis quality is poor, the sampling frequency is greatly limited, it is difficult to ensure that mass spectrum data at the highest point of a chromatographic peak can be collected, and the sensitivity of detection and the accuracy of quantitative analysis are affected are solved.

The application belongs to the field of molecular biology, and particularly relates to an insertion / deletion molecular marker for identifying wheat resistance to scab and application thereof, wherein the insertion / deletion marker is located on a 2D chromosome of wheat; and a characteristic sequence of the insertion / deletion marker is 21 bp, and a nucleotide sequence is represented by AACGGCAAAGGCAGGAATACA (SEQ ID No. 1). The application uses PCR and electrophoresis technology to perform genotype selection on a wheat scab-regulating gene, so as to provide a marker for molecular marker-assisted breeding of wheat resistance to scab, and has the advantages of good stability, high accuracy and the like.

The invention relates to the technical field of electrophoresis, and discloses an automatic dosing method for an electrophoresis tank, an electrophoresis system and electronic equipment.The method comprises the steps that tank liquid parameters of tank liquid in the electrophoresis tank and technological parameters of an electrophoresis technology are obtained; inputting the bath solution parameters and the process parameters into a pre-constructed dosage prediction model, and predicting to obtain to-be-supplemented dosage; and controlling the automatic dosing equipment to add chemicals into the electrophoresis tank based on the dosage to be supplemented. According to the automatic dosing method, the stability of the film thickness can be improved, the working efficiency and the product quality can be improved, the use cost can be reduced, and the full-flow digital intelligence capability can be improved.

The invention relates to the field of flow battery diaphragms, in particular to a method for continuously preparing a proton exchange membrane for a flow battery based on an electrophoresis technology. The method comprises the following steps: placing a resin solution in an electrophoresis tank, taking a continuous metal base band as an electrode, controlling current and voltage, moving charged anion and cation resin ions towards positive and negative film forming electrodes under the driving of an electric field, enriching on the metal base band, drying, curing, forming a film, and rolling. The proton exchange membrane prepared by utilizing an electrophoresis method can realize continuous production, and has better ion selectivity, mechanical property and conductivity, so that a flow battery has better battery performance, and a new thought is provided for the development of a flow battery diaphragm. The process is simple, and the problems of environmental protection and safety caused by volatilization of a large amount of solvents in a traditional tape casting method are solved.

The invention provides a method for detecting the content of boric acid based on capillary electrophoresis, which is used for analyzing and detecting the content of boric acid in a boric acid sample solution by utilizing the advantages of electrophoresis mobility difference, influence of electroosmotic flow, interaction among separation media and the like of a capillary electrophoresis technology. And the influence of a quality discrimination effect and a memory effect can be effectively eliminated.

This utility model relates to the field of electrophoresis technology and discloses a phosphating device for automotive parts before electrophoresis, comprising: a base frame; a pool body fixedly connected to the top of the base frame; a filter section disposed on the top of the pool body; and a cleaning section disposed inside the pool body. As the filter plate rises, a drive motor, driven by a connecting column, rotates the scraper, keeping it vertical. Due to the inclination of the triangular connecting frame and the filter plate, impurities slide, driving an electric valve to rotate and open the outlet, allowing some impurities to be transported along a trajectory to the inside of the collection box. Then, a cam is rotated; due to the strong blocking effect of the rotating column and one side of the pool body, the rotation angle of the rotating column is stabilized. Subsequently, a brake lever is pulled, causing the transmission plate to slide along the inclined trajectory, thereby driving the scraper to scrape and clean the impurities on the top of the filter plate.

The utility model relates to the technical field of SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis) gel electrophoresis, and discloses a rapid gel preparation device for SDS-PAGE gel electrophoresis, which comprises a mixing pipe and a plurality of material storage pipes, a communication channel is fixedly arranged between the bottoms of the material storage pipes and the mixing pipe, plugging pieces are arranged in the material storage pipes, the plugging pieces are used for plugging the communication channel, and the material storage pipes are connected with the mixing pipe. A jacking part is slidably connected into the mixing pipe, and the jacking part can penetrate through the communicating channel and jack the plugging part upwards when sliding upwards along the inner wall of the mixing pipe, so that the storage pipe communicates with the mixing pipe. A plurality of material storage pipes are fixedly mounted at the top of the mixing pipe, the plugging pieces and the jacking pieces are arranged between the material storage pipes and the mixing pipe, and whether the material storage pipes are communicated with the mixing pipe or not can be controlled through the plugging pieces and the jacking pieces, namely whether raw material liquid is released into the mixing pipe or not to be mixed can be controlled; all the raw material liquid can be conveniently added into the mixing pipe for mixing at one time.

The application provides an automatic electrophoresis device based on a micro-pump valve integrated chip, and belongs to the technical field of capillary electrophoresis. The device comprises an electrophoresis chip and at least one glue filling control unit. The electrophoresis chip has a micro-pump valve unit, which comprises a glue filling plunger and a plunger valve for controlling the opening and closing of a flow path. The glue filling control unit is provided with corresponding plunger driving elements and valve core driving elements. The glue filling control unit can slide relative to the electrophoresis chip, so as to be switched between a first coupling position and a first decoupling position. Through the sliding coupling and decoupling between the driving mechanism and the chip, the application solves the problem that the chip consumables are difficult to replace due to the fixed connection of the driving assembly. Meanwhile, through decoupling avoidance, the spatial interference of the driving mechanism on the sample injection module, the detection module and other modules in different process stages is eliminated, and the overall automation level of the device is improved.

The invention discloses a multifunctional molecular biology electrophoresis auxiliary device, and relates to the technical field of molecular biology electrophoresis, and the technical scheme is characterized in that the multifunctional molecular biology electrophoresis auxiliary device comprises an outer groove assembly, a preparation groove assembly is placed in the outer groove assembly, gel sampling comb driving parts are arranged on the two sides of the outer groove assembly, linear up-down driving parts are connected to the gel sampling comb driving parts, and a sampling comb clamping device is arranged between the gel sampling comb driving parts and the linear up-down driving parts. Supporting legs are arranged at the bottom of an outer tank body of the outer tank assembly, and a liftable supporting plate and fine needles are arranged in the outer tank assembly; vibration motors are arranged on the two sides of an inner tank body of the preparation tank assembly. The gel sampling comb driving piece is composed of an electric control linear sliding rail and an electric control sliding block, and the linear up-down driving piece moves up and down through a servo motor, a lead screw and the like. And the sampling comb clamping device can be used for stably clamping the gel sampling comb. According to the device, through cooperation of all parts, air in gel can be exhausted, gel preparation is more uniform, the position of a sampling comb can be controlled, deformation of a sampling nozzle during sampling is avoided, and the efficiency and quality of an electrophoresis experiment are improved.

The utility model relates to the technical field of motorcycle electrophoresis, and particularly discloses a motorcycle frame electrophoresis tank which comprises a tank body and an electrophoresis piece, a liquid adding assembly is arranged on one side of the top of the tank body, the bottom of the tank body is communicated and connected with a liquid discharging pipeline, and the tops of the two sides of the tank body are provided with material passing openings allowing a motorcycle frame to pass through in a hoisting mode. A sludge deposition bottom plate capable of lifting and sliding along the inner side wall of the tank body is mounted at the inner bottom of the tank body, a liquid outlet is formed in the sludge deposition bottom plate, a liquid filtering net is mounted at the top end of the liquid outlet, a liquid discharging control part is arranged between the bottom of the liquid outlet and a liquid discharging pipeline, and an anti-blocking sludge smashing mechanism is arranged on the upper surface of the sludge deposition bottom plate; the anti-blocking mud smashing mechanism comprises a motor, a rotating sleeve, a plurality of mud smashing rods and a mud smashing brush, the rotating sleeve and the motor are both located on one side of the liquid outlet, and the problems that sludge generated in the electrophoresis process of a traditional motorcycle frame easily causes blockage of the liquid outlet in the bottom of an electrophoresis tank, and electrophoresis liquid in the electrophoresis tank is inconvenient to discharge and replace regularly are solved.

The utility model relates to the technical field of wheel electrophoresis, in particular to a wheel electrophoresis air bag eliminating device which comprises an electrophoresis tank, a catenary track, a wheel lifting appliance and an air bubble eliminating device, the catenary track is positioned above the electrophoresis tank, one end of the wheel lifting appliance is hung on the catenary track, and the other end of the wheel lifting appliance is hung on the wheel, so that the wheel is immersed into the electrophoresis tank; the bubble removing device is arranged on the electrophoresis tank; the bubble eliminating device is provided with a tooth-shaped structure, the catenary track drives the wheel to walk along the tooth-shaped structure through the lifting appliance, and then a cavity formed by bubbles between the outer surface and electrophoresis liquid is eliminated. The device has the advantages that the air bag phenomenon in the electrophoresis process is solved through the tooth-shaped structure of the toothed plate, and the device is simple in structure and convenient to maintain and replace.

The invention belongs to the technical field of dairy product detection, and particularly relates to a method for detecting the proportion and activity of each whey protein in milk and dairy products through a fluorescent gel electrophoresis technology. Carrying out lauryl sodium sulfate-polyacrylamide gel electrophoretic analysis on the milk and dairy products marked by the protein fluorescent dye, firstly adding concentration gel for concentration, compressing the protein dispersed in a sample loading hole into a narrow sample band, then adding separation gel for separation, and according to the difference of molecular weights of different whey proteins and casein, determining the content of the whey protein and the casein. According to the method, whey proteins are separated from each other, migration rates in gel are different, effective separation is realized, finally, an electrophoretogram is obtained through a gel imaging system, a gray value of the electrophoretogram is subjected to quantitative processing by adopting gel image analysis software, and the proportion and activity of each whey protein are obtained through calculation. Compared with a traditional Coomassie brilliant blue dyeing method, the method is high in marking speed, does not need time-consuming dyeing and decolorizing steps, and is high in practicability.

The utility model relates to the technical field of vehicle body electrophoresis, and discloses a vehicle body electrophoresis auxiliary anode which comprises a supporting column and an anode main body arranged on one side of the supporting column, a moving mechanism and a dismounting mechanism are arranged on the supporting column and the anode main body, and a motor drives a rotating sleeve to rotate so as to drive a rotating rod to rotate. The rotating rod rotates to drive the fixing block to rotate left and right, the anode body can be driven to rotate left and right through rotation of the fixing block, the output end of the electric telescopic rod drives one end of the rotating plate to rotate upwards, one side of the rotating plate rotates downwards, and then the anode body can be driven to rotate downwards. The anode main body can be rotated and adjusted at multiple angles through the matching of the anode main body and the anode main body, so that the anode main body can be changed at multiple angles while extending into a vehicle body, the use applicability of the equipment is improved, and the electrophoresis uniformity and quality of the vehicle body are ensured.

The invention belongs to the technical field of amino acid detection and analysis, and provides a rapid analysis method for amino acid, which efficiently completes derivatization of amino acid and fluorescein isothiocyanate in a short time by utilizing a microwave-assisted reaction, and remarkably shortens the traditional time-consuming and tedious pretreatment time. A capillary electrophoresis technology is adopted, derivatized amino acid is separated under constant voltage, and by monitoring voltage and current signals in the electrophoresis process in real time, the migration charge density independent of single migration time is calculated to serve as a qualitative criterion. The separated components are subjected to high-sensitivity detection through a diaphragm coupled laser-induced fluorescence system. Finally, qualitative and quantitative analysis is performed in combination with migration time and migration charge density, and identification of various common amino acids can be realized without a standard substance. According to the invention, full-process automation from sample introduction to result output is realized, the analysis speed is high, the sample consumption is low, and the reproducibility is high.

The invention discloses a continuous electrophoretic coating device for special-shaped parts, which belongs to the technical field of electrophoresis and comprises an electrophoresis tank and an electrophoresis hanger. The electrophoresis hanging rack comprises a supporting frame, a swinging and rotating driving assembly, supporting plates, a supporting frame and a local protection tool set, in this way, after a workpiece is placed on the local protection tool set, the supporting frame is installed between the two supporting plates and fixed, then the supporting frame is placed in an electrophoresis pool, the swinging and rotating driving assembly is started, and the workpiece is placed on the supporting frame. The swing rotation driving assembly drives the supporting frame to rotate in the pool and swing left and right through the supporting plate, so that the workpiece makes full contact with pool liquid, the situation that cavities exist in dead corners of the workpiece is effectively avoided, and uniform electrophoretic coating of the workpiece is achieved. The plug block is inserted into the screw hole of the workpiece, the check block makes contact with the workpiece, then the connecting rod is controlled to drive the pressing block to move downwards so that the plug block can be gradually expanded till the plug block abuts against the screw hole of the workpiece, the protection effect on the screw hole of the workpiece is achieved, and the workpiece is supported and fixed through the screw hole.

The invention belongs to the technical field of molecular biology, and provides polymorphic primers of Chinese hippophae rhamnoides genome SSR molecular markers and application of the polymorphic primers. The SSR molecular marker is composed of 20 pairs of SSR molecular marker polymorphic primers, and the nucleotide sequences of the primers are as shown in SEQ ID NO.1-SEQ ID NO.40. The SSR molecular marker comprises 20 pairs of SSR molecular marker polymorphic primers. A large number of SSR sequences are mined by using transcriptomes, SSR capillary electrophoresis technology is combined, SSR loci with high measurement indexes Na value, I value and PIC value of genetic difference and front 20 of the sequence are screened, and Chinese sea-buckthorn molecular identity information is made and applied to Chinese sea-buckthorn geographic source identification. The SSR molecular marker is good in polymorphism primer specificity and high in polymorphism, and when the SSR molecular marker is applied to Chinese hippophae rhamnoides population genetic structure and resource genetic diversity analysis, the diversity and genetic structure of hippophae rhamnoides genetic level in China can be revealed more comprehensively, and a foundation is laid for formulating a genetic protection strategy.

The application belongs to the technical field of in-vitro detection, and particularly relates to a detection method of endogenous synthesis immunoglobulin in central nervous system based on MALDI-TOF MS. The application provides a kit for detecting and typing immunoglobulin in a sample and a method for detecting immunoglobulin in a sample, and solves the problems of low detection method flux, complicated experimental process, long time consumption, high experience requirement for detection personnel, and result interpretation being easily affected by electropherogram background of isoelectric focusing electrophoresis combined with immunofixed oligoclonal band electrophoresis (OCB) technology. The detection method provided by the application is more accurate, simpler to operate and easier to realize automation, has no subjective problems of manual interpretation, has lower detection cost, has higher detection flux, and is easier to popularize in clinical diagnosis and treatment.

This invention discloses a quantitative sample injection device and method for capillary electrophoresis, applied in the field of capillary electrophoresis technology. The key technical points are: it includes a sample vial and a buffer chamber, with a capillary tube fixedly connected between the sample vial and the buffer chamber; a three-way valve is also fixedly provided, with the capillary tube and the buffer chamber respectively fixedly connected to the three-way valve; a quantitative sample injection component for generating negative pressure to achieve sample injection is externally fixedly connected to the three-way valve; a shut-off valve is fixedly connected between the three-way valve and the buffer chamber; and a miniature stopcock valve is fixedly provided between the quantitative sample injection component and the three-way valve. The technical effect is: improving the accuracy of sample injection volume while reducing the cost of the injection device.

The invention relates to the technical field of electrophoresis, in particular to an electrophoresis device for automobile part machining, which comprises an electrophoresis box with a cylindrical cavity inside, a top cover is connected to the top of the electrophoresis box through screws, supporting seats are symmetrically fixed to the bottom of the electrophoresis box, a servo motor is arranged between the two supporting seats, and the servo motor is fixed to the electrophoresis box. An electrophoresis mechanism is arranged in the electrophoresis box, and the servo motor is in transmission connection with the electrophoresis mechanism; the electrophoresis mechanism comprises an upper fixing disc and a lower fixing disc which are rotationally connected with an inner cavity of the electrophoresis box. According to the electrophoresis device, assembly line type automatic electrophoresis operation of the strip-shaped automobile parts can be achieved by arranging the electrophoresis mechanism to be matched with driving of the servo motor; compared with the automobile parts without supporting and fixing points, automatic electrophoresis can be achieved, and compared with an operation mode of a traditional electrophoresis cradle, the electrophoresis efficiency of the automobile parts is higher, and the quality is better.

The utility model relates to the technical field of electrophoresis, in particular to an electrophoresis hanger for machining automobile parts. Comprising a main rod, a plurality of supporting rods, a plurality of hooks, a plurality of fixing plates and a plurality of sets of connecting assemblies, the fixing plates are fixedly arranged on the main rod, the supporting rods are connected with the corresponding fixing plates respectively, each supporting rod is provided with the hooks, each connecting assembly comprises a limiting arc block, a pull rod, an abutting spring, a movable block and an inserting rod, and the movable blocks are slidably connected with the fixing plates. The pull rod is fixedly connected with the movable block and penetrates through the fixed plate, the two ends of the abutting spring are fixedly connected with the fixed plate and the limiting arc block respectively, the limiting arc block is fixedly connected with the movable block, the inserting rod is fixedly connected with the supporting rod and provided with a fixed groove, the inserting rod is movably inserted into the movable groove, and the limiting arc block is matched with the fixed groove. By the adoption of the mode, the hanging tool can be rapidly combined and installed, personnel operation is easy and convenient, and time and labor are saved.

This invention belongs to the field of biomedical technology, specifically relating to a method and kit for improving the sensitivity and specificity of circulating tumor cell (CTC) detection. The method first treats anticoagulated blood with erythrocyte lysis buffer, centrifuges to obtain a cell suspension (including leukocytes and circulating tumor cells); then, a radiosensitizer is added and the suspension is irradiated; next, single-cell gel electrophoresis is used to detect the degree of DNA damage in the test cells; finally, leukocytes and tumor cells are distinguished based on cell morphology using a fluorescence microscope or fluorescence scanner. This invention is the first to detect the number and type of circulating tumor cells (CTCs) in peripheral blood based on ionizing radiation and radiosensitization effects, according to the degree of DNA damage in tumor cells. Compared with existing technologies, this detection method and kit are not only simple and rapid, but also significantly improve detection sensitivity and specificity. Furthermore, it is independent of the physical properties of cells and tumor cell surface markers, requires a small sample volume, is highly versatile, and can detect CTCs in different types of solid tumors.

The utility model relates to the technical field of electrophoresis, and disclose a kind of electrophoretic solution cooling device, including base, the base upper portion is provided with electrophoretic bin, the electrophoretic bin front is fixedly provided with control panel, the cooling mechanism is provided in the electrophoretic bin below, the electrophoretic bin outside is provided with stabilizing mechanism, the cooling mechanism includes connecting portion and cooling part. Through water pump drive coolant circulates between condensate tank, cooling machine, lower cooling seat cooling groove, form a cooling circulation system, this circulation can take away heat generated in the bottom of electrophoretic bin in time, make electrophoretic solution always be in suitable temperature range, ensure the stability and consistency of electrophoresis process, avoid adverse effects due to temperature fluctuation on electrophoresis effect, electric hydraulic rod works, promote upper cooling seat to move upwards, make the cooling groove between lower cooling seat and upper cooling seat expose, it is convenient to clean scale in cooling groove, keep the unobstructed of cooling system.

The application provides a preparation method of dimethyl imidazole cobalt modified manganese dioxide microspheres, which comprises the following steps: completely dissolving manganese dioxide microspheres in a methanol solution of cobalt nitrate, adding a methanol solution of 2-methyl imidazole, stirring, centrifuging, washing, and drying to obtain dimethyl imidazole cobalt modified manganese dioxide microspheres. The material has the advantages of easy synthesis, high specific surface area, high loading capacity, good permeability, short diffusion path, excellent thermal stability and the like. As a new type of enzyme immobilization carrier, acetylcholinesterase is immobilized on the dimethyl imidazole cobalt modified manganese dioxide microspheres through electrostatic interaction. The application also provides the application of the immobilized acetylcholinesterase in combination with capillary electrophoresis technology in screening of acetylcholinesterase inhibitors from Chinese traditional medicine Inula japonica. The immobilized acetylcholinesterase has the advantages of wide pH resistance, good thermal stability, reusability, high enzyme activity and the like.