Molecular beacon probe and kit for detecting equine influenza virus pathogens

A technology of molecular beacon probes and kits, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of difficult identification, small number of samples, and slow detection speed, etc. Effects of background ratio, improved repeatability and accuracy, and good specificity

Inactive Publication Date: 2020-08-04
SHANDONG VOCATIONAL ANIMAL SCI & VETERINARY COLLEGE
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Molecular beacon real-time fluorescence quantitative RT-PCR method is used to overcome the disadvantages of cumbersome virus isolation and difficult identification, slow detection speed of traditional RT-PCR, easy contamination, electrophoresis detection after amplification, and small number of samples for each detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular beacon probe and kit for detecting equine influenza virus pathogens
  • Molecular beacon probe and kit for detecting equine influenza virus pathogens
  • Molecular beacon probe and kit for detecting equine influenza virus pathogens

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] 1) Design primers and molecular beacon probes

[0041]Design primers and molecular beacon probes according to the partial nucleotide sequence of the PB1 gene of H3N8 downloaded from the GenBank database, wherein the partial nucleotide sequence of the PB1 gene is a 145bp fragment:

[0042] AAGGCCGGCAAACTTATGATTGGACCTTGAATAGGAATCAACCTGCTGCAACAGCACTTGCTAATACAATTGAAGTGTTCAGATCAAATGGTCTGACTTCCAATGAATCAGGGAGATTGATGGACTTCCTCAAAGATGTCATGGA

[0043] The primer pairs thus synthesized are:

[0044] PF:AGAATAAGTAGACAATCCAT;

[0045] PR: GGTATATGCTTCAGTACGTACA;

[0046] Molecular beacon probes are:

[0047] P probe

[0048] 5'Fam-CCGACAACTTATGATTGGACCTTGAAGTCGG-Dabcyle 3', the molecular beacon is a specific sequence of a neck ring structure composed of bases, in which the 5' end is marked with FAM, and the 3' end is marked with Dabcyle, the excitation wavelength of the fluorophore It is 494nm, and the emission wavelength is 515nm.

[0049] 2) Construction and preparation of qu...

Embodiment 2

[0070] 1) Design primers and molecular beacon probes

[0071] According to the nucleotide sequence of the HA gene of H3N8 downloaded from the GenBank database, select a highly conserved and specific nucleotide sequence to design primers and molecular beacon probes. The highly conserved and specific nucleotide sequence of the HA gene For a 172bp fragment:

[0072] ACCCATATGACATCCCTGACTATGCATCGCTCCGATCAATTGTAGCATCCTCAGGAACATTGGAATTCACAGCAGAGGGATTCACATGGACAGGTGTCACTCAAAACGGAAGAAGTGGAGCCTGCAAAAGGGGATCAACCGATAGTTTCTTTAGCCGACTGAATTGGCTAAC

[0073] The primer pairs thus synthesized are:

[0074] HF:GTACGTGGATCTCCTATGAC;

[0075] HR: CTTATGTGGCTCCTAATCTAGC;

[0076] Molecular beacon probes are:

[0077] H probe

[0078] 5'Fam-CCGACAACATTGGAATTCACAGCAGAGTCGG-Dabcyle 3', the molecular beacon is a specific sequence of a neck ring structure composed of bases, in which the 5' end is marked with FAM, and the 3' end is marked with Dabcyle, the excitation wavelength of the fluorophore I...

Embodiment 3

[0080] 5) Molecular beacon fluorescent quantitative PCR reaction:

[0081] With the cDNA obtained in step 4) as a template, the amplification system is as follows:

[0082] 2.5 μL 1.2mmol / L 10×PCR reaction buffer, 4 μL 15mmol / L MgCl 2 , 1 μL 50pmol / L upstream primer, 1 μL 50pmol / L downstream primer, 1 μL 50pmol / L molecular beacon probe, 2 μL 2mmol / L dNTP, 0.5U Taq enzyme, 1 μL DNA template, 1 μL 2.5mmol / L laconic acid, ddH 2 O supplemented to 25 μL. The reaction conditions for PCR amplification are: denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, amplification at 72°C for 30 seconds, and 40 PCR cycles; Fluorescent signal was detected. All the rest are completely consistent with Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular beacon probe and a kit for detecting equine influenza virus pathogens. The molecular beacon probe and the kit belong to the field of biotechnology. The kit comprisesa primer pair for detecting a PB1-D sequence of H3N8 and a molecular beacon probe, nucleotide sequence of upstream primer of primer pair is SEQ: 1; wherein the nucleotide sequence of the forward primer is SEQ: 1, the nucleotide sequence of the reverse primer is SEQ: 2, the nucleotide sequence of the molecular beacon probe is SEQ: 3, the 5'end of the molecular beacon probe is subjected to fluorescence labeling with 5 (6)-carboxyl fluorescein (FAM), and the 3 'end of the molecular beacon probe is subjected to fluorescence labeling with quenched fluorescence 4-(4'-oxane aminobenzene azo) benzoicacid (DABCYL). The kit can inhibit generation of fluorescence signals caused by non-specific binding of the molecular beacon probe and reduce the signal-to-background ratio, so that detection signalscan accurately reflect the number of templates, and the specificity, sensitivity, repeatability and accuracy of detection are improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular beacon probe and a kit for detecting equine influenza virus pathogens. Background technique [0002] Equine influenza virus (EIV) belongs to type A influenza virus, which causes influenza in equine animals, and can also infect dogs and other animals. The equine influenza virus genome consists of 8 negative-sense single-stranded RNA segments including M gene, HA gene and NA gene. Among them, the M genome sequence is highly conserved, while the HA and NA genomes are highly variable, and the variation of certain sites can lead to the emergence of different antigenic viruses. Although influenza viruses can be divided into 15 HA subtypes and 9 NA subtypes, so far, only two subtypes, H3N8 and H7N7, have been found in EIV. Virus isolation and serological tests are still commonly used methods for diagnosing equine influenza and typing EIV. However, these methods are...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/701C12Q2563/107C12Q2545/114C12Q2561/113
Inventor董建宝朱伟高楠楠索佳佳袁东芳
OwnerSHANDONG VOCATIONAL ANIMAL SCI & VETERINARY COLLEGE