Method for reprogramming ITNK cells based on CRISPR/Cas9

A reprogramming and cell technology, applied in the field of gene editing, can solve the problems of high toxicity and low efficiency of ITNK cells, and achieve the effects of strong killing ability, good in vitro expansion ability, and strong in vitro expansion ability.

Inactive Publication Date: 2020-09-01
GUANGDONG ZHAOTAI INVIVO BIOMEDICINE CO LTD
View PDF4 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the use of CRISPR / CAS9 technology to reprogram ITNK cells still faces problems such as low efficiency and high toxicity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for reprogramming ITNK cells based on CRISPR/Cas9
  • Method for reprogramming ITNK cells based on CRISPR/Cas9
  • Method for reprogramming ITNK cells based on CRISPR/Cas9

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] This embodiment provides a method for reprogramming ITNK cells, the specific steps are as follows:

[0061] 1. Gene sequences of sgRNA, cr-RNA and tracr-RNA.

[0062] (1) According to the Bcl11b gene, design three sgRNA targeting the gene, that is, SEQ ID NO.1~3, and send the sequence to the sequence synthesis company to synthesize the sequence, and connect the three sgRNAs to the PX458-gBCL11b vector containing the T7 promoter Above, the successful construction of the vector was verified by sequencing, and the specific sequence of the sgRNA used was as follows:

[0063] sgRNA1: gaccctgacctgctcacctg (SEQ ID NO.1)

[0064] sgRNA2: gaccatgaactgctcacttg (SEQ ID NO.2)

[0065] sgRNA3: gaagcagtgtggcggcagct (SEQ ID NO. 3);

[0066] (2) Through mMESSAGE mMACHINE TM The T7 Transcription Kit kit is used to obtain the mRNA product of the gRNA targeting the gene in vitro;

[0067] (3) The gene sequences of crRNA and tracrRNA used in the present embodiment are as follows:

...

Embodiment 2

[0082] In this example, the growth state and phenotype of cells in each experimental group in Example 1 were monitored and compared.

[0083] On the 9th day after electroporation, subgroups expressing both T cell marker CD3 and NK cell markers NKp46 and NKp30 appeared in the electroporation RNP group (RNP-A, RNP-B and RNP-C group) and the plasmid group.

[0084] Experimental results such as figure 1 As shown, in the CD8 positive cell population, the positive ratio of NKp30 in the plasmid group was only 39.6% (26.5%+13.1%), while the ratio of NKp30 in the electroporation RNP-A, B and C groups were 51.42%, 40.6% and 61.6% respectively , the proportion of NKp46 had no significant difference;

[0085] In the CD4-positive cell population, the proportion of NKp30 in the plasmid group was 40.35%, and that in the RNP-C group was 41.46%, which were similar.

[0086] Based on the above results, compared with direct electroporation of CRISPR / CAS9 plasmids, the proportion of T cells wit...

Embodiment 3

[0088] This example is used to compare the in vitro expansion ability of reprogrammed ITNK cells obtained by electroporation of RNP complexes and direct electroporation of plasmids.

[0089] After the electroporation was completed and the fresh medium was replaced, the growth status of the cells was monitored regularly; the cells were counted with trypan blue every other day to obtain figure 2 The in vitro expansion curves of each group of cells shown and the number of cells in different groups recorded in Table 1.

[0090] Table 1

[0091] group RNP-A group RNP-B group RNP-C group Plasmid set The number of cells in D2 / (×10 6 indivual)

[0092] The above results show that the starting cell number of each group is 2.5×10 6 Taking the day of electroporation as D1, and the day after electroporation (D3), only 0.98×10 cells in the ITNK plasmid group were directly electroporated. 6 , lower than the other three groups of electrotransfer RNP; after the com...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for reprogramming ITNK cells based on CRISPR / Cas9. The method comprises a step of transferring an RNP compound into activated T cells through electric conversion to obtain the ITNK cells. According to the method, the RNP compound is transferred into T cells through an electric conversion method; the T cells are converted into ITNK cells; the in-vitro reprogrammingefficiency is improved, the obtained ITNK cells have good in-vitro amplification capacity, the cell amplification multiple of the ITNK cells is 26.8-62.2 times on the fourteenth day after electric conversion, and the ITNK cells have a strong in-vitro killing performance. The reprogrammed ITNK cell preparation capability of the method is improved, so that more clinical patients are benefited.

Description

technical field [0001] The present invention relates to the technical field of gene editing, in particular to a CRISPR / Cas9-based gene editing method, in particular to a CRISPR / Cas9-based method for reprogramming ITNK cells. Background technique [0002] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats, regularly clustered interspaced short palindromic repeat system), CRISPR / Cas is a complex with endonuclease activity, wherein Cas is a CRISPR-related protein. CRISPR / Cas can recognize a specific DNA sequence, cut at a specific site to cause double-strand breaks (Double-strand breaks, DSB), and in the absence of a template, non-homologous end joining (Non-homologous end joining, NHEJ), resulting in frameshift mutation, leading to gene knockout. [0003] The CRISPR / Cas system is an immune defense system that originally existed in prokaryotes in nature to resist the invasion of foreign genetic materials such as phages or viruses. It provides bacteria with acqu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/113C12N9/22C12N15/90
CPCC07K14/82C12N5/0636C12N9/22C12N15/113C12N15/907C12N2510/00
Inventor秦乐吴迪蒋治武其他发明人请求不公开姓名
OwnerGUANGDONG ZHAOTAI INVIVO BIOMEDICINE CO LTD