Phenylboronic acid-modified high polymer material and application thereof in intracellular delivery of gene editing ribonucleoprotein compound

A polymer material and ribonucleoprotein technology, applied in the field of intracellular delivery of gene-edited ribonucleoprotein complexes, can solve the problem that polymer carriers cannot bind ribonucleoprotein complexes well

Active Publication Date: 2020-10-23
EAST CHINA NORMAL UNIV +1
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In order to solve the problem that polymer carriers in the prior art cannot bind ribonucleoprotein complexes well, the present invention innovatively provides a class of polymer materials modified with phenylboronic acid as carriers for intracellular delivery of ribonucleoprotein complexes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phenylboronic acid-modified high polymer material and application thereof in intracellular delivery of gene editing ribonucleoprotein compound
  • Phenylboronic acid-modified high polymer material and application thereof in intracellular delivery of gene editing ribonucleoprotein compound
  • Phenylboronic acid-modified high polymer material and application thereof in intracellular delivery of gene editing ribonucleoprotein compound

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1: Synthesis of protein and polypeptide intracellular delivery carriers P1-P6 based on polyamide-amine dendrimers and functional groups containing phenylboronic acid.

[0056] In a specific embodiment, the preparation method of the polymer material modified with phenylboronic acid is as follows: 4-bromomethylphenylboronic acid and the 5th generation polyamidoamine dendrimer are mixed according to different molar ratios (26: 1,38:1,96:1,128:1) into methanol solution, heated at 70°C for 24 hours, transferred to a dialysis bag, fully dialyzed in methanol and deionized water, separated and purified to obtain the product, respectively obtained 4 kinds Phenylboronic acid-modified dendrimers with different grafting ratios (as shown in formula (9)). according to 1 H NMR nuclear magnetic spectrum characterizes the connection efficiency of phenylboronic acid on the surface of polyamide-amine dendrimer, and calculates the average number of phenylboronic acid linked to eac...

Embodiment 2

[0063] Example 2: Comparison of intracellular delivery efficiency of gene editing ribonucleoprotein complexes (CRISPR-Cas9) containing phenylboronic acid-modified dendrimer materials P1-P6.

[0064]The specific operation method is as follows: firstly, sgRNA targeting AAVS1 (sgAAVS1) was prepared by in vitro transcription (the target of AAVS1 is GGCTCCCTCCCAGGATCCTCTC), and the activity of sgAAVS1 was determined by cutting the PCR fragment of the target gene in vitro. The 293T cells were seeded into 6-well plates overnight, and the protein delivery experiment was started when the 293T cell density reached more than 80%. Firstly, the CRISPR-Cas9 protein and sgAAVS1 were incubated at 37°C for 10 minutes to form a CRISPR-Cas9 / sgAAVS1 complex, and then the CRISPR-Cas9 / sgAAVS1 complex was mixed with six phenylboronic acid-modified dendrimers, P1-P6, respectively. After the materials are fully mixed, add 100 μL of serum-free DMEM medium, shake and mix well. The dose of CRISPR-Cas9 w...

Embodiment 3

[0066] Example 3: Preparation of a complex containing dendrimer material P4 modified with phenylboronic acid and gene editing ribonucleoprotein complex (CRISPR-Cas9), and using dynamic light scattering (DLS) to characterize the size and surface potential of the complex.

[0067] The specific operation method is as follows: mix the CRISPR-Cas9 protein with the P4 solution evenly, incubate at room temperature for 30 minutes, add 1 mL of deionized water to dilute, and use a laser nanometer to detect the size distribution and surface potential of the nanoparticles in the solution.

[0068] Experimental results: figure 1 Represents the size distribution and surface potential of the DLS-characterized complex formed by P4 and CRISPR-Cas9 protein prepared in the present invention. The results showed that the phenylboronic acid-modified dendrimer material P4 could form nanoparticles with a size of about 300 nm with CRISPR-Cas9 protein, and the surface potential of the particles was pos...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a phenylboronic acid-modified high polymer material in intracellular delivery of a gene editing ribonucleoprotein compound. The phenylboronic acid-modified high polymer material is composed of a cationic polymer and a phenylboronic acid functional group, wherein the phenylboronic acid functional group is covalently connected to the cationic polymer; and the cationic polymer comprises a polyamide-amine dendrimer, polypropyleneimine, polylysine and the like. The phenylboronic acid-modified high polymer material can be used as an intracellular delivery carrier of the gene editing ribonucleoprotein compound, i.e., a carrier for delivering the gene editing ribonucleoprotein compound from a place outside a cell to a place inside the cell. A method of using the phenylboronic acid-modified high polymer material as the intracellular delivery carrier of the gene editing ribonucleoprotein compound can achieve high efficiency, has good gene editing effects ondifferent gene loci of the same cell and different types of cells, can maintain the biological activity of the ribonucleoprotein compound, and is low in toxicity to cells and good in biocompatibility.

Description

technical field [0001] The invention relates to the fields of biotechnology, polymer chemistry, cell biology, etc., and specifically relates to a novel polymer material modified with phenylboronic acid and its application in intracellular delivery of gene editing ribonucleoprotein complexes. Background technique [0002] The clustered regularly interspaced short palindromic repeats sequences (CRISPR) system is derived from the adaptive immune system of bacteria and archaea, which is mainly used to resist exogenous nucleic acids from phages, plasmids, etc. invasion. Using this naturally occurring immune system, the CRISPR / Cas system has been developed as a new type of gene editing technology, which can target the target sequence of the genome or target multiple target sequences of the genome simultaneously for genome editing. The system has been widely used in the treatment of gene-related diseases, in vivo imaging of directional detection of genomic regions, identification ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C08G73/02C12N15/90
CPCC08G73/028C12N15/907
Inventor程义云平渊万涛刘崇懿吕佳
OwnerEAST CHINA NORMAL UNIV