DNAzymes for identifying pseudomonas aeruginosa as well as screening and detecting method and application

A Pseudomonas aeruginosa screening method technology, applied in the field of pathogenic bacteria detection and molecular biology, can solve the problem of detection of Pseudomonas aeruginosa with no DNAzyme, and achieve wide application value, strong specificity and effective detection Effect

Active Publication Date: 2020-12-22
JIANGSU OCEAN UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although bacteria-associated DNAzymes have been reported, no DNAzymes have been reported to detect Pseudomonas aeruginosa

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNAzymes for identifying pseudomonas aeruginosa as well as screening and detecting method and application
  • DNAzymes for identifying pseudomonas aeruginosa as well as screening and detecting method and application
  • DNAzymes for identifying pseudomonas aeruginosa as well as screening and detecting method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0055] 1. Preparation before screening

[0056] (1) Design of random library and PCR primers, the random library is a 75 nt sequence, and the 5' end is phosphorylated, the middle is a 35 nt random sequence, and the two sides are 20 nt primer sequences. Shanghai Sangon Bioengineering Co., Ltd. synthesized a DNA random library and related DNA sequences (5'-3') for in vitro screening.

[0057] Initial library: pGGACAAGAGGGGGATCTTGT-N 35 -GTTGTCAGCAGTCTGTCCAT

[0058] Primer 1: ATGGACAGACTGCTGACAAC

[0059] Primer 2: Biotin-TGCTGACAACTrAGGACAAGAGGGGGA

[0060] FAM-substrate: FAM-ATGGACAGACTGCTGACAACTrAGGACAAGAGGGGGA

[0061] (2) Pseudomonas aeruginosa was cultured with nutrient broth liquid medium, and the OD 600 nm The culture was stopped when it was close to 1, and the number of bacteria per milliliter was determined by the serial dilution coating method.

[0062] (3) Preparation of extracellular products: Divide 1 mL of all the culture solution into 1.5 mL sterile centrif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses DNAzymes for specific recognition of pseudomonas aeruginosa. Two DNAzymes for specific recognition and cleavage of pseudomonas aeruginosa and a substrate of the DNAzymes are obtained in total in the invention. The invention further elaborates screening and detection methods and application of the DNAzyme in detail. The DNAzyme capable of specifically recognizing the pseudomonas aeruginosa can form a secondary structure of a special loop and has a specific recognition effect on the pseudomonas aeruginosa, the fluorescently-labeled DNAzymes can detect 10< 6 > CFU / mL of the pseudomonas aeruginosa, and the detection range is larger than 1 * 10 < 6 > CFU / mL. The cleavage rate was 0.0167 min<- 1> by kinetic detection. The DNAzymes can be applied to the detection of the pseudomonas aeruginosa.

Description

technical field [0001] The invention belongs to the technical field of pathogenic bacteria detection and molecular biology, and specifically relates to Pseudomonas aeruginosa ) DNAzymes for specific detection and a screening method thereof, as well as a method and application thereof for detecting Pseudomonas aeruginosa. Background technique [0002] Pseudomonas aeruginosa ( P. aeruginosa ) is a Gram-negative bacillus widely distributed in nature, and it is also a common opportunistic pathogen on human skin and respiratory tract. Its pathogenic feature is to cause secondary infection, which mostly occurs when the body's immunity is weakened. Pseudomonas aeruginosa can cause red skin disease in fish, causing hemorrhage and inflammation of the fish body, and the fins fall off, seriously endangering aquaculture. Pseudomonas aeruginosa has strong viability and drug resistance, and it is not easy to be eliminated in the production process of drinking water. WHO has used Pseud...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12Q1/04C12Q1/00G01N21/64
CPCC12N15/113C12Q1/04C12Q1/001G01N21/6428C12N2310/127G01N2333/21Y02A50/30
Inventor吕明生秦铭灿王淑军卢静武航婕马小艺范诗慧田雪晴
OwnerJIANGSU OCEAN UNIV