Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Soybean GmEF1B gene mutant plant as well as preparation method and application thereof

A mutant and soybean technology, applied in the field of plant biology, can solve the problems that restrict the efficiency and accuracy of new variety breeding, and the scarcity of genetic resources

Active Publication Date: 2020-12-29
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the limitations of traditional breeding methods, the use of molecular methods to screen and identify effective disease-resistant genes is particularly important for the breeding of disease-resistant varieties. efficiency and accuracy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soybean GmEF1B gene mutant plant as well as preparation method and application thereof
  • Soybean GmEF1B gene mutant plant as well as preparation method and application thereof
  • Soybean GmEF1B gene mutant plant as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1. Soybean GmEF1B gene mutant plants.

[0033] The soybean GmEF1B gene mutant plant described in this embodiment, the mutant plant contains a mutated soybean GmEF1B gene, and the mutation refers to a base substitution in the 5'-GCTTCCCCGGCAATGCTCAA-3' nucleotide sequence in the coding region of the GmEF1B gene or deletion to change the encoded amino acid sequence; the nucleotide sequence of the soybean GmEF1B gene is shown in SEQ ID NO:1.

Embodiment 2

[0034] Example 2. The preparation method of soybean GmEF1B gene mutant plants.

[0035] The following example describes the preparation method of the soybean GmEF1B gene mutant plant of the present invention:

[0036] In the mutant plants described in this embodiment, the mutated GmEF1B gene refers to a base substitution or deletion in the 5'-GCTTCCCCGGCAATGCTCAA-3' nucleotide sequence in the GmEF1B gene coding region, so that the encoded amino acid sequence A change occurs; that is, the target nucleotide sequence is: 5'GCTTCCCCGGCAATGCTCAA 3' is located at the 203rd to 222nd base of the GmEF1B coding region. The preparation steps are as follows:

[0037] 1) Design gRNA single-target primers based on soybean GmEF1B gene.

[0038] First, the soybean GmEF1B gene was amplified, and the soybean variety Maple Arrow was used as the material. When the first group of three compound leaves grew, the material was collected, the total RNA was extracted, and the first strand of cDNA was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a soybean GmEF1B gene mutant plant as well as a preparation method and application thereof, and belongs to the technical field of plant biology. The soybean GmEF1B gene mutantplant is provided to clarify the disease-resistant function of soybean genes resistant to sclerotinia sclerotiorum and accelerate the breeding process of soybean varieties resistant to sclerotinia sclerotiorum, and contains a mutant soybean GmEF1B gene. The mutation means base substitution or deletion occurring to a 5'-GCTTCCCCGGCAATGCTCAA-3' nucleotide sequence in a GmEF1B gene coding region so as to change the coded amino acid sequence, and the mutant plant is prepared by a CRISPR / Cas9 gene editing method, and can be used for breeding soybean varieties resistant to sclerotinia sclerotiorum.

Description

technical field [0001] The invention belongs to the field of plant biotechnology, and in particular relates to a soybean GmEF1B gene mutant plant and a preparation method and application thereof. Background technique [0002] Soybean sclerotinia is a fungal disease caused by Sclerotinia sclerotiorum (Lib.) de Bary. It is a serious worldwide disease that directly affects the quality and yield of soybeans. When the disease is severe, the incidence rate is as high as 50%. % to 90%, or even extinct. Due to the limitations of traditional breeding methods, the use of molecular methods to screen and identify effective disease-resistant genes is particularly important for the breeding of disease-resistant varieties. efficiency and accuracy. Contents of the invention [0003] In order to clarify the disease-resistant function of soybean anti-sclerotinia related genes and to speed up the process of soybean anti-sclerotinia variety breeding, the invention provides a soybean GmEF1B ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82A01H6/54
CPCC12N15/113C12N15/8213C07K14/415C12N2310/10C12N2310/20
Inventor 邹佳男
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More