Soybean GmEF1B gene mutant plant as well as preparation method and application thereof
A mutant and soybean technology, applied in the field of plant biology, can solve the problems that restrict the efficiency and accuracy of new variety breeding, and the scarcity of genetic resources
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1. Soybean GmEF1B gene mutant plants.
[0033] The soybean GmEF1B gene mutant plant described in this embodiment, the mutant plant contains a mutated soybean GmEF1B gene, and the mutation refers to a base substitution in the 5'-GCTTCCCCGGCAATGCTCAA-3' nucleotide sequence in the coding region of the GmEF1B gene or deletion to change the encoded amino acid sequence; the nucleotide sequence of the soybean GmEF1B gene is shown in SEQ ID NO:1.
Embodiment 2
[0034] Example 2. The preparation method of soybean GmEF1B gene mutant plants.
[0035] The following example describes the preparation method of the soybean GmEF1B gene mutant plant of the present invention:
[0036] In the mutant plants described in this embodiment, the mutated GmEF1B gene refers to a base substitution or deletion in the 5'-GCTTCCCCGGCAATGCTCAA-3' nucleotide sequence in the GmEF1B gene coding region, so that the encoded amino acid sequence A change occurs; that is, the target nucleotide sequence is: 5'GCTTCCCCGGCAATGCTCAA 3' is located at the 203rd to 222nd base of the GmEF1B coding region. The preparation steps are as follows:
[0037] 1) Design gRNA single-target primers based on soybean GmEF1B gene.
[0038] First, the soybean GmEF1B gene was amplified, and the soybean variety Maple Arrow was used as the material. When the first group of three compound leaves grew, the material was collected, the total RNA was extracted, and the first strand of cDNA was...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com