A kind of antibody fusion protein targeting frizzled-7 and its preparation method and application

A fusion protein and antibody technology, applied in the field of bioengineering, can solve the problems of patient antibody response difference, affinity difference, decline, etc., and achieve the effect of preventing tumor immune escape

Active Publication Date: 2021-09-24
SHANGHAI UNIV OF MEDICINE & HEALTH SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are great differences in the ADCC effects of these antibodies; Zhang et al. found that the polymorphism of the FcγRIIIa gene leads to a difference or decrease in its affinity with the Fc fragment, which leads to differences in the patient's response to the antibody (Zhang W et al, FCGR2A and FCGR3A polymorphisms associated with clinical outcome of epidermal growthfactor receptor expressing metastatic colorectal cancer patients treated with single-agent cetuximab, 2006, J Clin Oncol, 24:3028)
In order to improve the recognition ability of antibody Fc fragments to NK cells, researchers use protein engineering techniques to mutate the amino acids of Fc fragments of antibodies and change the degree of glycosylation of Fc fragments; however, none of the above efforts can avoid FcγRIIIa polymorphisms. Individual Differences in Antibody Responses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of antibody fusion protein targeting frizzled-7 and its preparation method and application
  • A kind of antibody fusion protein targeting frizzled-7 and its preparation method and application
  • A kind of antibody fusion protein targeting frizzled-7 and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Construction of fusion protein SHH002-hu1-MICA

[0051] First, obtain the gene sequence (GeneID: 100507436, protein: Q29983) encoding human MICA protein α1, α2 and α3 extracellular domains from genebank, use it as a template, design primers, forward primer MICA-F: GAGCCTGTCTCCTGGCAAAGGAGGTG, reverse Primer pcDNA3.4-3R: GTTGATTGTCGAGATATCAAATTATC, PCR amplifies the MICA' fragment. The heavy chain construction of the fusion protein SHH002-hu1-MICA takes the SHH002-hu1 heavy chain gene H' and MICA' gene as templates, and performs overlapping PCR extension amplification to obtain the complete H'-MICA gene. Forward primer insert-F: GCTACGCGTGTCCACTCC , reverse primer IgG1-3R: TTTGCCAGGAGACAGGCTCAGGGACTTC. The PCR product was detected by 1.0% agarose gel electrophoresis, and the target gene was recovered by the agarose gel recovery kit. The final product of PCR amplification and the vector pcDNA3.4 were double-digested with restriction endonucleases. After the di...

Embodiment 2

[0053] Example 2: Expression, purification and identification of fusion protein SHH002-hu1-MICA

[0054] The recombinant plasmids H'-MICA-pcDNA3.4 and L-pcDNA3.4 were transiently transfected into EXPICHO-S cells with liposome transfection reagent, and the serum-free medium was replaced for protein expression.

[0055] 1. Take the cell culture supernatant, centrifuge at 8000rpm for 15min, filter the sample with a 0.22μm filter membrane and purify it with a Protein A column. Elute with 100 mM glycine buffer (pH 3.5, pH 2.7), collect the eluted peaks; and neutralize the collection with 1M Tris buffer (pH 9.0). The purified protein was identified by SDS-PAGE electrophoresis under non-reducing and reducing conditions, respectively, to identify the molecular weight of SHH002-hu1-MICA.

[0056] 2. Using Agilent HPLC 1100 instrument to further verify the purity of the purified fusion protein SHH002-hu1-MICA by SEC-HPLC method. The selected molecular exclusion chromatography column i...

Embodiment 3

[0066] Example 3: BLI experiment of fusion protein SHH002-hu1-MICA

[0067] The affinity of SHH002-hu1-MICA to rhFzd7 protein and rhNKG2D-Fc protein was verified by BLI method using protein interaction instrument Fortebio Octet Red96.

[0068] 1. Solution preparation: PBST buffer: 0.025% Tween 20 was dissolved in PBS with pH 7.2; stationary phase working solution: SHH002-hu1-MICA / SHH002-hu1 was prepared with PBST buffer to 100nM; rhFzd7 working solution: rhFzd7 was prepared with PBST buffer 1000nM, 500nM, 250nM, 125nM, 62.5nM, 31.25nM and 15.625nM; rhNKG2D working solution: rhNKG2D-Fc was prepared in PBST buffer to 300nM, 100nM and 33nM.

[0069] 2. Operation process: Open the Fortebio instrument and related software, and select the Advance Kientics experimental mode. First, the Anti-Human Fab-CH1 2nd Generation (FAB2G) Sensor was used to capture SHH002-hu1-MICA / SHH002-hu1, and then the captured fusion protein / parental antibody was used to bind different concentrations of the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antibody fusion protein targeting Frizzled-7, a preparation method and application thereof, and belongs to the field of bioengineering. Compared with the prior art, the present invention fuses and expresses the Fzd7-targeting humanized antibody SHH002-hu1 and MICA protein through genetic engineering. This design combines Fzd7-targeting therapy with immune activation for the first time, and utilizes the antibody of the fusion protein In part, it binds to tumor cells positively expressing Fzd7, and anchors MICA molecules on the surface of tumor cells; then uses MICA to specifically bind NKG2D, the surface membrane receptor of NK cells, to gather NK cells to tumor lesions and activate NK cells to play an important role in tumor cells. The killing effect of the antibody can avoid the immune escape of the tumor in conventional antibody therapy, and at the same time enhance the anti-tumor effect of the antibody.

Description

technical field [0001] The invention belongs to the field of bioengineering, and in particular relates to an antibody fusion protein targeting Frizzled-7 and its preparation method and application. Background technique [0002] Natural killer (NK) cells are cells of the innate immune system that exert cytotoxicity, play a key role in tumor immune surveillance, and are an important tool in tumor immunotherapy. The activation of NK cells is regulated by the balance between activating receptors and inhibitory receptors, and the main activating receptors of NK cells include Fc fragment receptor (FcγRIIIa) and NKG2D. A conventional drug for activating and rebuilding the body's tumor immunity is an antibody. Most of the anti-tumor antibodies widely used in clinical practice are IgG1 type, which can activate NK cells through the combination of Fc fragment and FcγRIIIa to exert antibody-dependent cell-mediated cytotoxicity. (antibody-dependent cell-mediated cytotoxicity, ADCC). Ho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/85C12N5/10C07K1/34C07K1/22C07K1/36A61K38/17A61K39/395A61P35/00
CPCA61K38/00A61P35/00C07K14/70539C07K16/2863C07K2317/24C07K2317/73C07K2317/92C07K2319/33C12N5/0682C12N15/85C12N2510/02C12N2800/107
Inventor解伟黄钢王进张坤驰孙吉杨浩王风仙赵慧杰
OwnerSHANGHAI UNIV OF MEDICINE & HEALTH SCI