Supercharge Your Innovation With Domain-Expert AI Agents!

A molecular marker, primer, method and kit for early screening of cervical cancer

A technology for molecular markers and cervical cancer, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems of low specificity, high sensitivity, excessive medical treatment, etc., and achieve detection results more specific effects

Active Publication Date: 2022-08-05
CENT SOUTH UNIV +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, hrHPV will naturally subside within a period of time. Although hrHPV screening results are objective, independent of cytologists, and have high sensitivity, the specificity is low (19.5%-28.8%), which leads to excessive medical treatment
However, there is no EDN3 gene methylation detection kit on the market, and the existing technology cannot quickly and efficiently perform relevant and accurate detection of cervical cancer at a low cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker, primer, method and kit for early screening of cervical cancer
  • A molecular marker, primer, method and kit for early screening of cervical cancer
  • A molecular marker, primer, method and kit for early screening of cervical cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Embodiment 1 A kind of specific primer for EDN3 methylation detection

[0051] The PCR primers and probes for EDN3 specific methylation of the present invention are designed according to the human whole genome sequence published by NCBI (National Center for Biotechnology Information), using Primer Premier3.0 and Methyl Primer Expressv1.0, and are designed by Yingwei Synthesized by Jieji (Shanghai) Trading Co., Ltd.

[0052] The base sequences of specific primer pairs to amplify EDN3 gene fragments from sample nucleic acid DNA are:

[0053] EDN3-F: GGAGTAGGGGTTGTGGTTT

[0054] EDN3-R: biotin-AATCCCCCCCCTAAATCCTTT

[0055] The sequencing primers for pyrosequencing of the obtained nucleic acid fragments are:

[0056] EDN3-S: TTTTTTTTAGGGTTTATAGTGATTT.

Embodiment 2

[0057] Embodiment 2 A kind of detection kit for EDN3 methylation

[0058] The EDN3 methylation detection kit includes: PCR reaction solution, sequencing primers, negative control, positive control, and blank control.

[0059] The PCR reaction solution includes: nuclease-free water, 10×Ex Buffer (containing Mg2+), dNTPs, EDN3-F, EDN3-R, and Ex Taq enzymes. Final concentrations of various substances PCR buffer (1×), dNTP (0.25mM), EDN3-F (0.4uM), EDN3-R (0.4uM), Ex Taq enzyme (1U / reaction).

[0060] The following primers and probe sequences are included:

[0061] EDN3-F: GGAGTAGGGGTTGTGGTTT

[0062] EDN3-R: biotin-AATCCCCCCCCTAAATCCTTT

[0063] The sequencing primers include: EDN3-S (10uM).

[0064] The sequences of the sequencing primers included are as follows:

[0065] EDN3-S: TTTTTTTTAGGGTTTATAGTGATTT

[0066] The negative control is 20ng / uL of C33A cell line gDNA;

[0067] The positive control is 20ng / uL of Caski cell line gDNA;

[0068] The blank control was nucl...

Embodiment 3

[0069] Example 3 Application of the kit of the present invention in the diagnosis of cervical cancer

[0070] The nuclease-free water, 10×Ex Buffer, Ex Taq enzyme and dNTPs used in the present invention were purchased from Yubao Bio (Dalian) Co., Ltd.;

[0071] The positive control is the gDNA of the Caski cell line, and the negative control is the gDNA of the C33A cell line;

[0072] The DNA extraction kit is HiPure Blood&Tissue DNA Kit (Magen);

[0073] The transformation kit is, EZ DNA Methylation-Direct™ Kit (ZYMO).

[0074] The biological materials used in the present invention are all from the Xiangya Medical Laboratory of Central South University.

[0075] method:

[0076] 1. Biological samples:

[0077] From June 2019 to June 2020, cervical exfoliated cells from 40 normal people and 35 cervical cancer patients were collected at Xiangya Medical Laboratory of Central South University.

[0078] 2. Extraction of cervical exfoliated cell DNA:

[0079] 1. Take 1mL of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker, primer, method and kit for early screening of cervical cancer. The molecular marker is obtained by methylation of EDN3 gene, and the methylation of EDN3 gene is No. 339 of SEQ ID NO:4 Methylation of four CpG sites at position ‑351, the primers include a specific primer pair for amplifying the EDN3 gene fragment from the sample nucleic acid DNA and a sequencing primer for pyrosequencing the obtained nucleic acid fragment. Further, the present invention provides a method for obtaining molecular markers for early screening of cervical cancer, and a detection kit is developed. Early detection and early treatment of cervical cancer provides a simple and effective detection method.

Description

technical field [0001] The present invention relates to the technical field of in vitro diagnostic molecular markers, in particular to molecular markers, primers, methods and kits for early screening of cervical cancer. Background technique [0002] Cervical cancer is the fourth most common malignant tumor that threatens women's health. Among female malignant tumors, cervical cancer ranks second after breast cancer. Modern medicine believes that the most effective treatment for cervical cancer is early detection, early diagnosis and early treatment. At present, the clinical cervical cancer screening methods in China have made great contributions to the health of Chinese women, but they also have their inevitable defects. [0003] First, traditional cytological screening methods, including bus smear and liquid-based cytology (TCT), have high specificity and positive predictive value, but they always have limitations such as low sensitivity, poor repeatability, and subjectiv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12Q1/6869C12N15/11
CPCC12Q1/6886C12Q1/6869C12Q2600/154C12Q2600/106C12Q2531/113C12Q2565/301
Inventor 李清周宏灏李书陈焱安宇航杨礼朱鹏
Owner CENT SOUTH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More