A molecular marker, primer, method and kit for early screening of cervical cancer
A technology for molecular markers and cervical cancer, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems of low specificity, high sensitivity, excessive medical treatment, etc., and achieve detection results more specific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Embodiment 1 A kind of specific primer for EDN3 methylation detection
[0051] The PCR primers and probes for EDN3 specific methylation of the present invention are designed according to the human whole genome sequence published by NCBI (National Center for Biotechnology Information), using Primer Premier3.0 and Methyl Primer Expressv1.0, and are designed by Yingwei Synthesized by Jieji (Shanghai) Trading Co., Ltd.
[0052] The base sequences of specific primer pairs to amplify EDN3 gene fragments from sample nucleic acid DNA are:
[0053] EDN3-F: GGAGTAGGGGTTGTGGTTT
[0054] EDN3-R: biotin-AATCCCCCCCCTAAATCCTTT
[0055] The sequencing primers for pyrosequencing of the obtained nucleic acid fragments are:
[0056] EDN3-S: TTTTTTTTAGGGTTTATAGTGATTT.
Embodiment 2
[0057] Embodiment 2 A kind of detection kit for EDN3 methylation
[0058] The EDN3 methylation detection kit includes: PCR reaction solution, sequencing primers, negative control, positive control, and blank control.
[0059] The PCR reaction solution includes: nuclease-free water, 10×Ex Buffer (containing Mg2+), dNTPs, EDN3-F, EDN3-R, and Ex Taq enzymes. Final concentrations of various substances PCR buffer (1×), dNTP (0.25mM), EDN3-F (0.4uM), EDN3-R (0.4uM), Ex Taq enzyme (1U / reaction).
[0060] The following primers and probe sequences are included:
[0061] EDN3-F: GGAGTAGGGGTTGTGGTTT
[0062] EDN3-R: biotin-AATCCCCCCCCTAAATCCTTT
[0063] The sequencing primers include: EDN3-S (10uM).
[0064] The sequences of the sequencing primers included are as follows:
[0065] EDN3-S: TTTTTTTTAGGGTTTATAGTGATTT
[0066] The negative control is 20ng / uL of C33A cell line gDNA;
[0067] The positive control is 20ng / uL of Caski cell line gDNA;
[0068] The blank control was nucl...
Embodiment 3
[0069] Example 3 Application of the kit of the present invention in the diagnosis of cervical cancer
[0070] The nuclease-free water, 10×Ex Buffer, Ex Taq enzyme and dNTPs used in the present invention were purchased from Yubao Bio (Dalian) Co., Ltd.;
[0071] The positive control is the gDNA of the Caski cell line, and the negative control is the gDNA of the C33A cell line;
[0072] The DNA extraction kit is HiPure Blood&Tissue DNA Kit (Magen);
[0073] The transformation kit is, EZ DNA Methylation-Direct™ Kit (ZYMO).
[0074] The biological materials used in the present invention are all from the Xiangya Medical Laboratory of Central South University.
[0075] method:
[0076] 1. Biological samples:
[0077] From June 2019 to June 2020, cervical exfoliated cells from 40 normal people and 35 cervical cancer patients were collected at Xiangya Medical Laboratory of Central South University.
[0078] 2. Extraction of cervical exfoliated cell DNA:
[0079] 1. Take 1mL of...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com