Method for constructing MLH1 gene knockout cell line

A construction method and gene knockout technology, applied in the field of genetic engineering, to achieve low cost and increase the positive rate

Inactive Publication Date: 2021-03-16
WUHAN AIBO TAIKE BIOTECH CO LTD
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there are no reports about using the CRISPR / Cas9 system to knock out the MLH1 gene and construct cell lines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing MLH1 gene knockout cell line
  • Method for constructing MLH1 gene knockout cell line
  • Method for constructing MLH1 gene knockout cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1: vector construction

[0040] 1) sgRNA design of MLH1 gene

[0041] For the MLH1 gene (gene name: MLH1, gene ID number: 4292, see https: / / www.ncbi.nlm.nih.gov / gene / ?term=4292 for gene details), search and download the MLH1 part on the Genebank website Genome sequence (Seq-A):

[0042] GATTGGCTGAAGGCACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCAAAATGTCGTTCGTGGCAGGGGTTATTCGGCGGCTGGACGAGACAGTGGTGAACCGCATCGCGGCGGGGGAAGTTATTCCAGCGGCC; in the mRNA introduction, link to the Ensemble website, find its exon sequence and mark it.

[0043] Use online software (http: / / crispor.tefor.net / ) to design sgRNA, input the above exon sequence, set and retrieve several sgRNA sequences, and analyze the position of sgRNA on the gene sequence and the off-target of the sgRNA ( Off-target) information, from which one optimal upstream sgRNA sequence is selected, as shown in Seq-1; one optimal downstream sgRNA sequence, as shown in Seq-2, is specifically shown in Table 1:

[0044] Ta...

Embodiment 2

[0063] Example 2. Preparation of MLH1 gene knockout HeLa cell line

[0064] 1. PX459M-MLH1-sgRNAs transfected HeLa cells

[0065] 1) Cells were inoculated in a 12-well plate, and the suspension of HeLa cells (from Wuhan Puruosai Life Science and Technology Co., Ltd., product number: CL-0101) was taken, and the mixture was divided into 2.5×10 5 Inoculate the number of cells per well, spread evenly into 2 wells of a 12-well plate, add 1mL complete medium (containing 10% fetal bovine serum, 1% double antibody) respectively, and place in a cell incubator for 12-16 hours;

[0066]2) To prepare the transfection complex, take out 2 sterile EP tubes, add 50 μL serum-free and antibiotic-free DMEM basal medium respectively, and add 3 μg of PX459M-MLH1-sgRNAs recombinant plasmid (experimental group) to the first sterile EP tube, Add 3 μg of PX459M-GFP plasmid (control group) to the second sterile EP tube, mix well, and call it solution A; take out another sterile EP tube, add 100 μL ser...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for constructing an MLH1 gene knockout cell line, and relates to the technical field of gene engineering. According to the method, a CRISPR / Cas9 system is used to prepare an MLH1 gene knockout cell line, firstly designing two sgRNA sequences for the MLH1 gene, and constructing recombinant plasmids by utilizing molecular cloning technology; then transfecting the recombinant plasmids to HeLa cells, verifying the activity of sgRNA through PCR, carrying out puromycin drug screening and monoclonal treatment, extracting genome DNA and total protein of the monoclonalcell strain, and carrying out MSH1 gene level sequencing identification and expression detection of protein level to obtain an MSH1 gene knockout HeLa cell line. The MSH1 gene knockout HeLa cell lineconstructed by the invention is a cell line with stable inheritance of genes. The method provided by the invention can be used for directional knockout of the MSH1 gene to cause functional inactivation of the MSH1 gene, which has the characteristics of simplicity, convenience, high efficiency, quickness, low cost and the like, and has important significance for research on functions and related pathways of the MSH1 gene.

Description

【Technical field】 [0001] The invention relates to the technical field of genetic engineering, in particular to a method for constructing MLH1 gene knockout cell lines. 【Background technique】 [0002] DNA mismatch repair gene (DNA mismatch repair gene, MMR) was first discovered in bacteria and yeast, and its analogues were also found in the human genome. Studies have confirmed that this gene is involved in human hereditary nonpolyposis colorectal cancer cancer (HNPCC) and sporadic colorectal cancer (SCRC) play an important role in the pathogenesis. DNA mismatch repair genes are neither oncogenes nor tumor suppressor genes, but another type of tumor-related genes. This is another important discovery in the molecular mechanism of tumor-related tumors after oncogenes and tumor suppressor genes. [0003] hMLH1 is a member of the MMR family. The gene is located at 3p21 and is a homologue of the bacterial mismatch repair gene mutL. ​​It is related to about 30% of HNPCC. The full-l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85C12N15/66C12N5/10C12R1/91
CPCC12N15/113C12N15/85C12N15/66C07K14/47C12N5/0693C12N5/0682C12N2310/20C12N2510/00
Inventor李军程扬项阳赵家顺
OwnerWUHAN AIBO TAIKE BIOTECH CO LTD