Check patentability & draft patents in minutes with Patsnap Eureka AI!

SNP marker related to vallisneria identification and application of SNP marker

A technology of labeling and licorice, which is applied in the field of SNP markers related to the identification of licorice, can solve the problems of naming and classification confusion, long cycle of morphological identification methods, low reliability of morphological identification results, etc., to achieve improved efficiency, high accuracy, cost saving effect

Active Publication Date: 2021-03-26
SHANGHAI TAIHE WATER ENVIRONMENTAL TECH DEV CO LTD +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, there are many kinds of Erythrina galerica used in engineering, and the names and classifications are confused. Because the morphology of Erythrina flavescens is greatly affected by environmental and subjective factors, the reliability of morphological identification results is low, and the cycle of morphological identification methods is long. Molecular markers are necessary to distinguish different subspecies of C.
[0003] SNP marker (single nucleotide polymorphism marker) is the most researched, hottest and most widely used molecular marker in the current development of genetic markers among molecular markers. Using SNP markers can quickly and accurately identify different subspecies of C. Grass SNP marker development method has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP marker related to vallisneria identification and application of SNP marker
  • SNP marker related to vallisneria identification and application of SNP marker
  • SNP marker related to vallisneria identification and application of SNP marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0130] Example 1 Screening of polymorphic SNP site markers

[0131] (1) Primer design

[0132] The Primer 3 software was used to develop SNP primers for the first 100 SNP sites of Erytheria miltiorrhiza from Taihe Water Co., Ltd., and the primer sequences are shown in Table 3. Sanger sequencing was used to verify the SNPs obtained by RAD-seq sequencing. A total of 5 samples of GS1a, GS4a, TH7, SH14, and HH23 were selected for sequencing verification of 100 sites. Tailing primers were used for amplification, and the general Common- F(AGTCACGACGTTGTAAAACGAC), the amplification system and procedure are as follows:

[0133] Table 1 Amplification program

[0134]

[0135] Table 2 Amplification system

[0136]

[0137] (2) Development test

[0138] 29 loci with preliminary polymorphisms were obtained through Sanger sequencing screening, and then population verification was performed using SNAPSHOT. The experimental procedure is as follows:

[0139] Take 1 μl of DNA sampl...

Embodiment 2

[0162] Embodiment 2 and 3 are paired with the dwarf type bitter grass (GS) and 14 wild bitter grass groups (Taihu Lake TH, Honghu HH, Shanghai SH, Huai'an HA, Huangshan HS, Hangzhou HZ, Guangzhou GZ, Dali to the dwarf type bitter grass (GS) selected and bred by Taihe Water Company, Dali DL, Kunming KM, Guiyang GY, Liuzhou LZ, Changsha CS, Yingtan YT, Jingdezhen JDZ) as examples, use the 22 SNP polymorphic sites screened in Example 1 to carry out the identification process and build its phylogenetic tree.

[0163] (1) Sample collection and storage: collected the dwarf bitter grass (GS) bred by Taihe Water Company and 14 wild bitter grass populations (Taihu TH, Honghu HH, Shanghai SH, Huaian HA, Huangshan HS, Hangzhou HZ, Guangzhou GZ, Dali DL, Kunming KM, Guiyang GY, Liuzhou LZ, Changsha CS, Yingtan YT, Jingdezhen JDZ), in the laboratory for three days, soak in 5‰potassium permanganate dilution for 15min to remove microorganisms on the leaf surface , to avoid contamination caus...

Embodiment 3

[0249] Embodiment 3 constructs phylogenetic tree

[0250] Sample collection, genomic DNA extraction, and PCR amplification procedures are the same as in Example 2. The PCR amplification products were sequenced. According to the sequencing results, a phylogenetic tree was constructed for 15 populations (18 samples) using the 22 polymorphic SNP sites described in this application, and Phylip.695 was used to construct the ML according to the Maximum Likelyhood Method. cluster plot ( figure 2 ). According to the constructed phylogenetic tree, we can intuitively see the population kinship relationship between the tested Elephantia miltiorrhiza and the dwarf Elephantiae elegans strains bred by Taihe Water Co., Ltd.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant molecular markers, in particular to an SNP marker related to vallisneria identification and an application of the SNP marker. The SNP marker comprises one or more of first to twenty-second SNP marker. The invention also provides a primer group and kit for detecting the SNP marker related to vallisneria identification. The related SNP marker for vallisneria identification fills the technical blank of vallisneria SNP molecular marker development, can realize high-throughput operation, has very high accuracy, is simple in data reading, saves the cost, improves the efficiency, provides a scientific basis for rapid identification and evaluation of the genetic relationship of all vallisneria subspecies, and provides a theoretical and data support for establishing a vallisneria molecular assisted breeding technology platform, and an efficient detection method is provided for breeding high-quality vallisneria varieties. Theoretical basis and technical means are provided for evaluating genetic characteristics of eel grass varieties in China, identifying specific eel grass varieties and the like, and the method has important theoretical value and application significance.

Description

technical field [0001] The invention relates to the field of plant molecular markers, in particular to SNP markers related to the identification of bitter weed and its application. Background technique [0002] Vallisneria, commonly known as "bend grass" and "water leek", belongs to Angiospermae, Monocots, Helobiae, Hydrocharitaceae, perennial stemless Submerged herbaceous plants with stolons and linear or band-shaped leaves. They grow in streams, rivers and other environments. They are widely distributed all over the world. They are the building species and important components of freshwater ecosystems. Erytheria gallis has a strong ability to adsorb suspended pollutants, and has the ability to remove nitrogen and phosphorus. It can effectively alleviate the degree of eutrophication in water bodies, effectively inhibit the reproduction and growth of algae, and provide guarantee for the subsequent growth of other aquatic plants, making it a water purification agent. , the pi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156C12Q1/6858C12Q2600/13C12Q2531/113C12Q2565/125
Inventor 何文辉谭梦何培民张晟曼
Owner SHANGHAI TAIHE WATER ENVIRONMENTAL TECH DEV CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More