Construction of curvularia lunata steroid 11beta-hydroxylase CYP5103B6 mutant and application thereof

A mutant and hydroxylase technology, applied in the fields of genetic engineering and enzyme engineering, can solve the problems of low conversion rate, poor specificity of hydroxylation, and low feeding

Inactive Publication Date: 2021-04-06
TIANJIN UNIV OF SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Using Curvularia crescens to transform RS has the disadvantages of low feed, low conversion rate, poor specificity of hydroxylation, and low yield.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of curvularia lunata steroid 11beta-hydroxylase CYP5103B6 mutant and application thereof
  • Construction of curvularia lunata steroid 11beta-hydroxylase CYP5103B6 mutant and application thereof
  • Construction of curvularia lunata steroid 11beta-hydroxylase CYP5103B6 mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Construction of pYES2-103168 recombinant Saccharomyces cerevisiae vector

[0051] 1. Amplification of CYP5103B6 gene 103168 of Curvularia lunata

[0052] Using Curvularia crescenae CYP5103B6 gene 103168 as a template, design upstream and downstream primers with BamHI and EcoRI restriction sites for PCR amplification. The primers were synthesized by Beijing Huada Gene Company.

[0053] F: CGGGATCCTACGTAATGGACCCTCAGACCGTTGGTC

[0054] R: GGAATTCTCAAACAACAACTCTCTTGAAGGCC

[0055] (1) PCR reaction system:

[0056]

[0057]

[0058] (2) PCR reaction conditions:

[0059] >55℃ program

[0060]

[0061] or <55℃ program

[0062]

[0063] PCR products were verified to be correct by agarose gel electrophoresis, such as figure 2

[0064] 2. Purification and digestion of PCR products

[0065] The PCR product was digested with DpnI enzyme template, placed in a metal bath at 70°C for 20min (enzyme inactivation), and the PCR amplified fragment was recove...

Embodiment 2

[0072] Embodiment 2: Construction of mutants T291Y, M365A, A372F

[0073] (1) Site-directed mutagenesis technology amplifies the target fragment:

[0074] The plasmid pYES2-103168 was used as a template, and T291Y-F / R, M365A-F / R, and A372F-F / R were used as primers for polymerase chain reaction, and the primers were synthesized by Beijing Huada Gene Company. Primers for site-directed mutagenesis are as follows:

[0075] T291Y-F: CAAGTACCAGTTGTCTCTTATCTTCG

[0076] T291Y-R: TGGTACTTGGCCAATTCTTGGATAC

[0077] M365A-F: CCGCGACCAGTTTCACTAGAAGGG

[0078] M365A-R: GTCGCGGTTGGTCCGGTGAATCTC

[0079] A372F-F: GGTTCAGAAAAGGGAATCACCTTG

[0080] A372F-R: TTCTGAACCTTCTAGTGAAACTGGTC

[0081] Carry out site-directed mutagenesis according to the above-mentioned PCR amplification procedures to obtain site-directed mutation target vector fragments L1 (T291Y), L2 (M365A), and L3 (A372F). Take 2 μL of the PCR product and verify the band size by agarose gel electrophoresis. See Figure 5 sho...

Embodiment 3

[0084] Embodiment 3: Construction of mutant L4 (T291Y / M365A), L5 (T291Y / A372F), L6 (M365A / A372F)

[0085] 1. Amplify the target fragment by site-directed mutagenesis:

[0086] Using plasmid L1 (T291Y) as template and M365A-F / R as primers, polymerase chain reaction was used for site-directed mutagenesis to obtain site-directed mutation target vector fragment L4 (T291Y / M365A); using plasmid L1 (T291Y) as template, A372F -F / R as primers, use polymerase chain reaction for site-directed mutagenesis, and obtain site-directed mutation target vector fragment L5 (T291Y / A372F); use plasmid L2 (M365A) as template, A372F-F / R as primers, use polymerase The site-directed mutation was carried out by chain reaction to obtain the target vector fragment L6 (M365A / A372F) for site-directed mutation. Primers were synthesized by Beijing Huada Gene Company.

[0087] M365A-F: CCGCGACCAGTTTCACTAGAAGGG

[0088] M365A-R: GTCGCGGTTGGTCCGGTGAATCTC

[0089] A372F-F: GGTTCAGAAAAGGGAATCACCTTG

[0090] A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention provides a curvularia lunata steroid C11 beta-hydroxylase mutant L6 and a curvularia lunata steroid C11 beta hydroxylase mutant L7. The DNA sequences are shown as DNA SEQ ID NO: 14 and DNA SEQ ID NO: 16. Compared with C11 beta-hydroxylase CYP5103B6, the specificity of converting steroid substrates 11-deoxycortisol by the mutants L6 and L7 is obviously improved, and byproducts are obviously reduced. The invention further provides an expression vector based on heterologous overexpression of mutants L6 and L7 and a steroid transformation process of the expression vector, and precious materials (genes and strains) and basic data support are provided for researching and developing a process for producing hydrocortisone by efficient C11 beta-hydroxylation 11-deoxycortisol.

Description

[0001] Summary [0002] The invention relates to screening C11β-hydroxylase CYP5103B6 mutant with high steroid hydroxylation specificity by using directed evolution, site-directed mutation and Saccharomyces cerevisiae expression platform. Technical field: [0003] The invention applies genetic engineering and enzyme engineering technology, and specifically relates to C11β-hydroxylase mutant and its application. Background technique: [0004] Steroids, also known as steroids, are a class of compounds with cyclopentane polyhydrophenanthrene as the core. Steroid hormone drugs have pharmacological activities such as anti-inflammation, anti-infection, and anti-allergy, and are widely used in diseases such as rheumatism, organ transplantation, and endocrine disorders. The physiological and pharmacological activities of steroid hormones depend on the functional groups introduced at specific sites in the steroid skeleton. The current methods for modifying steroid structure include...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/81C12P33/06C12R1/865
CPCC12N9/0071C12Y114/11035C12N15/81C12P33/06
Inventor刘晓光李金红路福平
OwnerTIANJIN UNIV OF SCI & TECH