Construction method of a mouse model with conditional mTERT overexpression and application thereof

A construction method and mouse model technology, applied in the biological field, can solve problems such as inability to achieve TERT overexpression and inability to control the time when mTERT begins to overexpress

Active Publication Date: 2021-04-06
FUDAN UNIV SHANGHAI CANCER CENT
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Previous research teams have constructed K5-TERT mice, which can achieve K5 promoter-driven mTERT overexpression, but cannot achieve TERT overexpression in K5-negative tissues, and cannot control the time when mTERT begins to overexpress

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of a mouse model with conditional mTERT overexpression and application thereof
  • Construction method of a mouse model with conditional mTERT overexpression and application thereof
  • Construction method of a mouse model with conditional mTERT overexpression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] refer to figure 1, This example provides a method for constructing a conditional mTERT overexpressed mouse model, which uses CRISPR / Cas9 technology to insert CAG-LSL-Tert-3XFlag- IRES-EGFP-wpre-polyA expression cassette, the specific steps are as follows:

[0042] Step 1: Construct a targeting vector by seamless cloning technology, the targeting vector contains 3.3kb 5' homology arm, CAG promoter, loxp-stop-loxp, TERT-3XFlag-IRES-EGFP-WPRE-polyA and 3.3kb 3 'homology arm;

[0043] Step 2: Microinject Cas9 mRNA, gRNA and the above-mentioned targeting vectors into the fertilized eggs of C57BL / 6J mice to obtain F0 generation mice, and identify homologous recombination-positive F0 generation mice, which are conditional mTERT transgenic mice. Expressed mouse model.

[0044] Wherein, the sequence of the above-mentioned gRNA is (5'-3') GGGGACACACTAAGGGAGCT (SEQ ID NO.: 1); the map of the targeting plasmid vector is as follows figure 2 The names corresponding to the variou...

Embodiment 2

[0059] In this embodiment, the F0 generation positive mice in Example 1 were mated with wild-type C57BL / 6J mice, and the F1 generation mice were bred, and the F1 generation was confirmed to be positive by PCR identification and sequencing ( Figure 4 , wherein, mutant type: 617bp, heterozygous type: 617bp and 192bp, wild type: 192bp), wherein, the primer sequences used in this PCR identification are as follows:

[0060] P1 (5'-3'): TCAGATTCTTTTATAGGGGACACA (SEQ ID NO.: 6);

[0061] P2 (5'-3'): TAAAGGCCACTCAATGCTCACTAA (SEQ ID NO.: 7);

[0062] P3 (5'-3'): GGTGTTGTCGGGGAAATCATCGTC (SEQ ID NO.: 8);

[0063] P4 (5'-3'): AGGAGCCTGCCAAGTAAC (SEQ ID NO.:9).

[0064] The reaction system adopted is as follows:

[0065] Reactive components Volume (μl) wxya 2 o

14.9 10×Taq PCR Buffer 2 2.5mMdNTP 1 P1 (10pmol / μl) 0.5 P2 (10pmol / μl) 0.5 Taq DNA Polymerase* 0.1 Genomic DNA 1 total 20 wxya 2 o

14.9 10×T...

Embodiment 3

[0070] In this example, mice with conditional mTERT overexpression were mated with TPO-CreERT2 tool mice, and the offspring mTERT overexpression was verified by qPCR and Anti-Flag IHC.

[0071] 1. Use the Trizol method to extract the total RNA of the mouse thyroid tissue, reverse transcribe it with the full gold reverse transcription kit, and use TAKARA SYBR Green qPCR reagent to detect the expression level of TERT mRNA. The primers used in qPCR are as follows:

[0072] F(5'-3'): TCAAACCCCAGAACACGTAC (SEQ ID NO.: 10);

[0073] R(5'-3'): GCACATGAAGCGTAGGAAGAC (SEQ ID NO.: 11).

[0074] qPCR results such as Figure 5 shown. It can be seen from the results that mTERT mRNA level was overexpressed.

[0075] 2. To TERT; TPO-CreER T2 Two weeks after induction with intraperitoneal injection of tamoxifen, the thyroid and trachea were removed for paraffin embedding. Use 3-5um thick paraffin sections, oven at 65°C for 1h, hydrate with xylene and gradient alcohol, use sodium citrate ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a construction method of a mouse model with conditional mTERT overexpression and an application thereof. The construction method comprises the following steps: constructing a targeting vector through a seamless cloning technology, wherein the targeting vector comprises a 3.3 kb 5'homologous arm, a CAG promoter, loxp-stop-loxp, TERT-3XFlag-IRES-EGFP-WPRE-polyA and a 3.3 kb 3'homologous arm; cas9 mRNA, gRNA and the targeting vector are microinjected into fertilized eggs of wild type mice to obtain F0-generation mice, homologous recombination positive F0-generation mice are identified, F1-generation mice are obtained through breeding after backcross, and the F1-generation mice are conditional mTERT overexpressed mouse models. The mouse constructed by the construction method provided by the invention can mate with different Cre tool mice to realize specific overexpression in various tissues, organs and cell types of the whole body. The mouse can be used for modeling various transgenic models for researching embryo and nerve development, senescence, wound repair, tumor occurrence, development and treatment, and the mating of the mouse and a CreERT tool mouse can control the time of TERT overexpression through tamoxifen.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for constructing a conditional mTERT overexpression mouse model and its application. Background technique [0002] There is almost no telomerase activity in most normal differentiated tissues of the human body, but telomerase activity can be detected in more than 90% of malignant tumors, suggesting that telomerase plays an important role in the process of tumor development. The expression level of TERT mRNA is directly proportional to the activity of telomerase. As one of the main subunits of telomerase, TERT (telomerase reverse transcriptase) can use TERC (telomerase RNA gene) as a template to combine with other subunits. Working together to lengthen telomeres. [0003] TERT has multiple activation pathways in tumors. At present, there have been reports of promoter point mutation, copy number variation, epigenetic modification, virus integration, gene fusion or rearrangem...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85A01K67/027
CPCC12N15/8509C12N9/1276C12Y207/07049A01K67/0278A01K2267/03A01K2227/105A01K2217/072
Inventor 王玉龙于鹏程余发星
Owner FUDAN UNIV SHANGHAI CANCER CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap