Specific gene of pholiota adipose and application of specific gene
A specific, scale-capable technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as difficulty in distinguishing, loss of electrolytes, circulatory disorders, etc., achieving wide applicability and easy operation. , the effect of high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1: Determination of the specific short sequence of the umbrella
[0027] Based on data analysis of a large number of species in the genus Pholiota squarrosoides, a 31bp specific short sequence SEQ ID NO.1: ATTGAATTACCTATCCAAGGTGACTTGGGGA of the poisonous mushroom Pholiota squarrosoides was screened out. BLAST alignment was carried out on this 31bp sequence, and the result that the sequence coverage and similarity were 100% was that there was and only the umbrella (such as figure 1 shown), indicating that the short sequence is unique to Umberella apicula. If this short sequence of 31 bp exists in the ITS1 sequence of the sample to be tested, it can be judged that the species is C. Therefore, the short sequence can be used to quickly and accurately identify the poisonous mushroom A. apicatus.
Embodiment 2
[0028] Example 2: Method for Identifying Capricornus apricots from Confusing Edible Mushrooms
[0029] (1) Samples to be tested: (see Table 1) 3 copies of Umbrella chinensis collected in Hunan Province, Jilin Province and Heilongjiang Province; And 2 parts of the lemon scale umbrella from Heilongjiang Province, 1 part of the fatty scale umbrella (yellow umbrella) from Jilin Province and 2 parts of the Lime umbrella from Jilin Province.
[0030] (2) Take 15-20 mg of sample tissue (with a part of gills), and extract DNA with Kangwei Plant Whole Genome DNA Extraction Kit produced by Kangwei Century Company after grinding.
[0031] (3) PCR amplification: amplify DNA fragments, perform polymerase chain reaction (PCR), and amplify with specific primers;
[0032] The primer pair sequences were forward primer PhsITS1-1F: 5′-GGATTGCTGTGTAGAAATACTTGGC-3′ and reverse primer PhsITS1-1R: 5′-TACAAAACGTGCACAGGTGGAA-3′. Primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.;...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com