Check patentability & draft patents in minutes with Patsnap Eureka AI!

Specific gene of pholiota adipose and application of specific gene

A specific, scale-capable technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as difficulty in distinguishing, loss of electrolytes, circulatory disorders, etc., achieving wide applicability and easy operation. , the effect of high accuracy

Active Publication Date: 2021-04-30
JILIN AGRICULTURAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, poisonous mushrooms are often mixed in wild edible mushrooms sold in the market, mainly because edible mushrooms and some poisonous mushrooms are very similar in shape and characteristics, especially after drying, they are mixed together and it is difficult to distinguish
For example, the mushrooms sold in the market called "thorn mushrooms" actually include a variety of yellow mushrooms with scales on the surface of the cap, such as yellow umbrella Pholiota adiposa, lemon scale umbrella Pholiota limonella, golden hair scale umbrella Pholiota aurivella, etc. However, it is often mixed with the poisonous mushroom Pholiota squarrosoides with very similar characteristics such as color and cap scales. It is difficult for non-professional morphological identification experts to distinguish them, and it is easy to be poisoned by mistake. Symptoms are nausea, vomiting, abdominal cramping, diarrhea, which may be accompanied by symptoms such as anxiety, sweating, chills, rapid heartbeat and, in severe cases, muscle cramps, circulatory disturbance, or loss of electrolytes
In addition, due to the lack of professional morphological identification experts in primary medical units, and the samples of poisonous mushrooms are often incomplete after poisoning incidents, samples need to be extracted from leftovers, cooked mushrooms or vomit for identification, which is not conducive to the identification of poisonous mushrooms. Accuracy of identification of mushroom species hampers timely targeted treatment of poisoned patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific gene of pholiota adipose and application of specific gene
  • Specific gene of pholiota adipose and application of specific gene
  • Specific gene of pholiota adipose and application of specific gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Determination of the specific short sequence of the umbrella

[0027] Based on data analysis of a large number of species in the genus Pholiota squarrosoides, a 31bp specific short sequence SEQ ID NO.1: ATTGAATTACCTATCCAAGGTGACTTGGGGA of the poisonous mushroom Pholiota squarrosoides was screened out. BLAST alignment was carried out on this 31bp sequence, and the result that the sequence coverage and similarity were 100% was that there was and only the umbrella (such as figure 1 shown), indicating that the short sequence is unique to Umberella apicula. If this short sequence of 31 bp exists in the ITS1 sequence of the sample to be tested, it can be judged that the species is C. Therefore, the short sequence can be used to quickly and accurately identify the poisonous mushroom A. apicatus.

Embodiment 2

[0028] Example 2: Method for Identifying Capricornus apricots from Confusing Edible Mushrooms

[0029] (1) Samples to be tested: (see Table 1) 3 copies of Umbrella chinensis collected in Hunan Province, Jilin Province and Heilongjiang Province; And 2 parts of the lemon scale umbrella from Heilongjiang Province, 1 part of the fatty scale umbrella (yellow umbrella) from Jilin Province and 2 parts of the Lime umbrella from Jilin Province.

[0030] (2) Take 15-20 mg of sample tissue (with a part of gills), and extract DNA with Kangwei Plant Whole Genome DNA Extraction Kit produced by Kangwei Century Company after grinding.

[0031] (3) PCR amplification: amplify DNA fragments, perform polymerase chain reaction (PCR), and amplify with specific primers;

[0032] The primer pair sequences were forward primer PhsITS1-1F: 5′-GGATTGCTGTGTAGAAATACTTGGC-3′ and reverse primer PhsITS1-1R: 5′-TACAAAACGTGCACAGGTGGAA-3′. Primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.;...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a specific gene of pholiota adipose and an application of the specific gene, a short sequence of the specific gene is shown as SEQ ID NO.1: ATTGAATTACCTATCCAAGGTGACTTGGGGA, and a method for identifying pholiota adipose molecules by using the specific gene comprises the following steps: (1) extracting genome DNA from a to-be-detected sample tissue; (2) by taking the genome DNA extracted in the step (1) as a template, carrying out polymerase chain reaction by using a pholiota adipose specific primer to obtain an amplified DNA product; (3) sequencing the DNA product obtained by amplification in the step (2); and (4) splicing and proofreading sequencing results to obtain an amplified fragment, detecting whether the specific gene short sequence SEQ ID NO.1 exists in the amplified fragment or not, and identifying the sample as pholiota adipose if the specific gene short sequence SEQ ID NO.1 exists in the amplified fragment. The specific short sequence and the method provided by the invention can be used for rapidly, accurately and accurately identifying the poison mushroom pholiota adiposa from the easily confused edible mushrooms, and the specific short sequence is easy to amplify, simple and convenient to operate and wide in applicability.

Description

technical field [0001] The application belongs to the technical field of identification of poisonous mushrooms, and in particular relates to a specific gene of Amanitia cuspidatum and its application. Background technique [0002] Wild edible fungi are delicious, nutritious and have certain health value, so they are deeply loved by people. However, poisonous mushrooms are often mixed in wild edible mushrooms sold in the market, mainly because edible mushrooms and some poisonous mushrooms are very similar in shape and characteristics, especially after drying, they are mixed together and it is difficult to distinguish them. For example, the mushrooms called "thorn mushrooms" sold in the market actually include a variety of yellow mushrooms with scales on the surface of the cap, such as yellow umbrella Pholiota adiposa, lemon scale umbrella Pholiota limonella, golden hair scale umbrella Pholiota aurivella, etc. However, it is often mixed with the poisonous mushroom Pholiota sq...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895
Inventor 田恩静高崇华谢晓梅郑媛曹广乘
Owner JILIN AGRICULTURAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More