Nano antibody for resisting B cell maturation antigen and application of nano antibody

A nanobody, B cell technology, applied in the field of biomedicine, can solve problems such as not achieving ideal results

Active Publication Date: 2021-05-18
HUADAO SHANGHAI BIOPHARMA CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The concept of Chimeric antigen receptor T cells (CAR-T) has appeared as early as 1989, but it has not achieved the desired effect in clinical trials.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nano antibody for resisting B cell maturation antigen and application of nano antibody
  • Nano antibody for resisting B cell maturation antigen and application of nano antibody
  • Nano antibody for resisting B cell maturation antigen and application of nano antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] This example is used for the construction and panning of the phage nanobody library, and ELISA is used for preliminary screening. Specific steps are as follows:

[0065] (1) Construction of phage nanobody library

[0066] Bactrian camels were immunized with BCMA-Fc expressing the extracellular region, and after the titer was verified by ELISA, 200 mL of peripheral blood was drawn; lymphocytes were sorted, and peripheral blood mononuclear lymphocyte precipitates were obtained, and RNA was extracted; III reverse transcriptase uses RNA as a template to synthesize the first-strand cDNA, and then uses nested PCR to amplify the VHH gene; inserts the VHH gene into the pMECS phage display vector, and after electrotransforming TG1 competent cells, take an appropriate amount of bacterial liquid for library identification , all the remaining cultures were evenly spread on LB / AMPGLU plates, and the lawn was collected after the bacteria grew out, and 1 / 3 of the volume of 50% glyce...

Embodiment 2

[0080] In this example, the candidate clones were screened using the flow cytometry fluorescence sorting technique (Fluorescence activated Cell Sorting, FACS).

[0081] Carry out cell culture according to the standard cell culture protocol, use trypsin to digest cells to prepare BCMA-positive and negative cell suspensions; 6 cell / mL; Add 2×10 to each well in a V-bottom 96-well plate 5After centrifuging at 300g for 5min, remove the supernatant, add the crude extract of VHH antibody to resuspend the cells, and incubate at 4°C for 1h;

[0082] After centrifuging at 300g for 5 minutes, remove the supernatant, resuspend the cells in Flow Buffer, dilute the APCanti-his antibody to 2 μg / mL with Flow Buffer, resuspend the cells in 100 μL per well, and incubate at 4 °C for 1 hour; wash the cells with Flow Buffer 3 times, then use 200 μL Flow Buffer Cells were resuspended and analyzed by flow cytometry.

Embodiment 3

[0084] In this example, the VHH-mIgG2a Fc nanobody was expressed and purified, and the antibody affinity was measured. In order to further identify the screened antibodies, the antibodies need to be expressed by mammalian cells. Therefore, a plasmid vector expressing VHH with a mouse Fc tag was first constructed, which was denoted as C-4 pCP.Stuffer-mCg2a-FC, and the specific steps were as follows:

[0085] 1. Using PCR to amplify BCMA VHH B8, the primers are:

[0086] HDB8-F (SEQ ID NO. 10):

[0087] CGCGATTCTTAAGGGTGTCCAGTGCGAGGTGCAGCTGGTGGA;

[0088] HD-B8-R (SEQ ID NO. 11):

[0089] GCATGGAGGACAGGGCTTGATTGTGGGGCTAGACACTGTCACCTG

[0090] The reaction system is shown in Table 2, and the amplification program is shown in Table 3 below:

[0091] Table 2

[0092]

[0093] table 3

[0094]

[0095] 2. The enzyme digestion system is shown in Table 4. The enzyme digestion temperature is 37°C and the time is 6 hours. The PCR purification kit was used for purification...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nano antibody for resisting a B cell maturation antigen and an application of the nano antibody. A heavy chain variable region of the nano antibody for resisting the B cell maturation antigen comprises a complementary determining region 1 as shown in SEQ ID NO. 1, a complementary determining region 2 as shown in SEQ ID NO. 2 and a complementary determining region 3 as shown in SEQ ID NO. 3. The antibody screened by using a phage display nano antibody library has a specific CDR region, and the obtained antibody can be specifically bound with a BCMA antigen and has good affinity; When being used as an antigen binding structural domain to construct a chimeric antigen receptor and a CAR-T cell, the antibody has obvious killing activity on BCMA positive tumor cells. Therefore, the nano antibody has a wide application prospect in the aspect of immunotherapy of multiple myeloma.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a nanobody against B cell mature antigen and its application. Background technique [0002] Multiple myeloma (multiple myeloma, MM) is a malignant proliferation of plasma cells, characterized by abnormal proliferation of clonal plasma cells in the bone marrow, secreting monoclonal immunoglobulin or its fragments (M protein), and leading to related organs or tissues damage. Common clinical manifestations include bone pain, anemia, renal insufficiency, and infection. MM ranks second in hematological malignancies in many countries, accounting for about 10% of hematological malignancies. There is no exact epidemiological survey data on the incidence of MM in my country. It is generally estimated to be about 1 / 100,000, and the median survival period of multiple myeloma is 3.5. [0003] Although the current induction therapy for MM shows some curative effect, almost ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/28C12N15/13C07K19/00C12N15/867C12N5/10A61K39/00A61P35/00
CPCC07K16/2878C07K14/7051C07K14/70517C07K14/70578C12N5/0636C12N15/86A61K39/001117A61P35/00C07K2317/565C07K2317/56C07K2317/567C07K2319/02C07K2319/03C07K2319/33C07K2319/74C12N2740/15043C12N2800/107C12N2510/00A61K2039/5156A61K2039/804C07K2317/569
Inventor狄升蒙侯莉余学军
OwnerHUADAO SHANGHAI BIOPHARMA CO LTD