Vaccine containing codon-optimized mycobacterium tuberculosis fusion protein AH

A Mycobacterium tuberculosis, codon optimization technology, applied in the field of molecular biology, can solve problems such as poor protection effect

Active Publication Date: 2021-05-28
CHINA AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ag85A is the antigen of the new poxvirus vector vaccine that first entered the clinical stage, but the results of clinical trials show that the protective effect is not good, which may be related to the presence of a single antigen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine containing codon-optimized mycobacterium tuberculosis fusion protein AH
  • Vaccine containing codon-optimized mycobacterium tuberculosis fusion protein AH
  • Vaccine containing codon-optimized mycobacterium tuberculosis fusion protein AH

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021]Example 1 Preparation method of recombinant protein AH

[0022]1.1AH construction and induction expression

[0023](1) The original gene sequence of AH fusion expressed, such as SEQ ID NO.1:

[0024]ATGCAGCTTGTTGACAGGGTTCGTGGCGCCGTCACGGGTATGTCGCGTCGACTCGTGGTCGGGGCCGTCGGCGCGGCCCTAGTGTCGGGTCTGGTCGGCGCCGTCGGTGGCACGGCGACCGCGGGGGCATTTTCCCGGCCGGGCTTGCCGGTGGAGTACCTGCAGGTGCCGTCGCCGTCGATGGGCCGTGACATCAAGGTCCAATTCCAAAGTGGTGGTGCCAACTCGCCCGCCCTGTACCTGCTCGACGGCCTGCGCGCGCAGGACGACTTCAGCGGCTGGGACATCAACACCCCGGCGTTCGAGTGGTACGACCAGTCGGGCCTGTCGGTGGTCATGCCGGTGGGTGGCCAGTCAAGCTTCTACTCCGACTGGTACCAGCCCGCCTGCGGCAAGGCCGGTTGCCAGACTTACAAGTGGGAGACCTTCCTGACCAGCGAGCTGCCGGGGTGGCTGCAGGCCAACAGGCACGTCAAGCCCACCGGAAGCGCCGTCGTCGGTCTTTCGATGGCTGCTTCTTCGGCGCTGACGCTGGCGATCTATCACCCCCAGCAGTTCGTCTACGCGGGAGCGATGTCGGGCCTGTTGGACCCCTCCCAGGCGATGGGTCCCACCCTGATCGGCCTGGCGATGGGTGACGCTGGCGGCTACAAGGCCTCCGACATGTGGGGCCCGAAGGAGGACCCGGCGTGGCAGCGCAACGACCCGCTGTTGAACGTCGGGAAGCTGATCGCCAACAACACCCGCGTCTGGGTGTACTGCGGCAACGGCAAGCCGTCGGATCTGGGTGGCAACAACCTG...

Embodiment 2

[0031]Example 2 Evaluation of immunity effects of subunit vaccine AH

[0032]2.1AH immunogenicity and protective evaluation

[0033]50 6-8 weeks of female C57BL / 6 mice were randomly divided into 5 groups, 10 in each group, a normal control group (CONTROL), BCG control group (BCG), polymycoplasm and AH immunization group (AH- P), polymeric adjuvant control group (P), attacking model group (M.BOVIS). The intranasal immunotic dose of polymethics and AH is 20 μg / only, a total of 3 weeks per interval. BCG control group mouse skin immunization BCG during the second immunization (105CFU / only), 3 mice were selected for 3 mice for 3 weeks after 3 weeks after the last immunization. Spleen cells were separated, and the spleen cells were stimulated with antigen AH 24 h. After 24 h, the cell supernatant IFN-γ level was determined, and the lung tissue separation lymphocytes were used to detect the number of T cells generated by IFN-γ, and the bronchial alveolar lavewater (BALF) was used for IgA l...

Embodiment 3

[0036]Example 3. Experimental results

[0037]The AH original sequence constructed with overlapping PCR is connected to the expression vector PET-30A (+), and transformed into BL21 (DE3), recombinant expression of the original sequence induced expression, bacterial protein via SDS-PAGE gel electrophoresis After the Kakas Bright blue staining, the results showed that the protein expected size position (about 54 kDa) protein strip had no significant difference before the induced bacteria protein was induced.figure 1 A). However, after the recombinant expression of the AH sequence containing a codon-optimized AH sequence, the significant strip is visible in the position of the protein expected size (figure 1 B), use anti-HIS tag antibody for WesternBlot identification, a single strip appears on the NC film, in line with the expected size (figure 1 C). SDS-PAGE gel electrophoresis and Caucas were dyed, and the purification of the purified AH purity was greater than 90%.figure 1 D) and use ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a codon-optimized mycobacterium tuberculosis fusion gene, a corresponding fusion protein, a vaccine, application in tuberculosis prevention and a preparation method. The method comprises the following steps: carrying out fusion expression on a mycobacterium tuberculosis infection early secretion antigen Ag85A and a latency expression antigen HspX, connecting the two antigen genes by using flexible Linker (GGGGS)3, carrying out codon optimization on a fusion gene sequence according to the DNA codon bias of escherichia coli, and then connecting the gene sequence to a vector pET-30a(+) for escherichia coli expression. The purified recombinant protein Ag85A-HspX (AH for short) and polyinosinic cell (PolyI:C) are used for intranasal immunization of mice, and the result proves that the recombinant protein has good immunogenicity and a protective effect of resisting mycobacterium bovis infection.

Description

Technical field[0001]The present invention belongs to the field of molecular biology and vaccine, which provides a codon optimized tuberculosis fusion gene, and corresponding fusion protein, vaccine, in preventing tuberculosis applications and preparation methods.Background technique[0002]Tuberculosis is a chronic infectious disease mainly caused by Mycobacterium Tuberculosis, referred to as M.TB and Nao M. M. Bovis, still threatening global health. As one of the world's ten causes, tuberculosis is also a single killer in a single infectious disease. And the drug tuberculosis is still a global public health threat. Therefore, there is an urgent need to develop safe and effective tuberculosis vaccines to alleviate global tuberculosis burden. Because the Bacille Calmette-Guérin, BCG has more limitations, such as invalid for adult tuberculosis and latent infection, more and more new tuberculosis vaccines are continuous development and clinical verification. According to statistics, 14 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C07K19/00A61K39/04A61K39/39A61P31/06
CPCC07K14/35A61K39/04A61K39/39A61P31/06C07K2319/00C12N2800/22A61K2039/55561
Inventor周向梅梁正敏李浩王元智葛昕
OwnerCHINA AGRI UNIV