Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of OGT as target in preparation of medicine for treating abnormal secretion of glucagon in diabetes

A technology for glucagon and abnormal secretion, applied in the field of biology, can solve the problems such as the production mechanism that has not yet been seen, affecting the secretion of glucagon, and achieve the effects of inhibiting proliferation and reducing secretion.

Inactive Publication Date: 2021-06-04
BINZHOU MEDICAL COLLEGE
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the one hand, the intracellular O-GlcNAc level can serve as a nutrient sensor (sensor) to regulate cell metabolic pathways under physiological conditions; on the other hand, when the O-GlcNAc level is disturbed, the body will undergo a series of pathological reactions, such as diabetes and heart disease and cancer, etc., but there is no report on the mechanism of O-GlcNAc glycosyltransferase OGT and diabetes, and there is no report on whether it will affect the secretion of glucagon

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OGT as target in preparation of medicine for treating abnormal secretion of glucagon in diabetes
  • Application of OGT as target in preparation of medicine for treating abnormal secretion of glucagon in diabetes
  • Application of OGT as target in preparation of medicine for treating abnormal secretion of glucagon in diabetes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Construction of islet α cell OGT-specific knockout mouse model

[0023] 1. Adenovirus sh-OGT vector construction

[0024] (1) Design three shRNA targets for the mouse Ogt gene homology region, the specific sequences are as follows:

[0025] shRNA-1:5'-GCAGCTTATCTTCGTGCCTTA-3'; (SEQ ID NO.1)

[0026] shRNA-2:5'-CCCATTTCTTTCAGCAGAAAT-3'; (SEQ ID NO.2)

[0027] shRNA-3:5'-GCTCTTAATATGCCCGTTATT-3'; (SEQ ID NO.3)

[0028] And design corresponding primers for each target, the primer sequences are as follows:

[0029] oligo-1F: CCGGGCAGCTTATCTTCGTGCCTTACTCGAGTAAGGCACGAA GATAAGCTGCTTTTTG; (SEQ ID NO. 4)

[0030] oligo-1R: AATTCAAAAAGCAGCTTATCTTCGTGCCTTACTCGAGTAAGG CACGAAGATAAGCTGC; (SEQ ID NO. 5)

[0031] oligo-2F: CCGGCCCATTTTCTTTCAGCAGAAATCTCGAGATTTCTGCTGAA AGAAATGGGTTTTTG; (SEQ ID NO. 6)

[0032] oligo-2R: AATTCAAAAACCCATTTCTTTCAGCAGAAATCTCGAGATTTCTGCTGAAAGAAATGGG; (SEQ ID NO. 7)

[0033] oligo-3F: CCGGGCTCTTAATATGCCCGTTATTCTCGAGAATAACGGGCAT ATTAAGAGCTTTTTG;...

Embodiment 2

[0052] Example 2 Detection of the effect of OGT knockout on mouse islet function in the OGT-specific knockout mouse model constructed in Example 1

[0053] 1. Detection of cell proliferation ability

[0054] Cell Counting Kit-8 (CCK8) reagent was used to detect the proliferative ability of pancreatic islet α cells. The specific process of the detection was as follows: After the cells were adhered to the wall, they were transfected with shRNA-Ogt virus for 24 hours, and after washing with PBS, follow the medium and CCK8 reagent 10: Add the reaction solution at a ratio of 1 (100 μL per 96 wells). Incubate in a 37°C incubator for 30 minutes to 4 hours, and measure the OD value at 450nm wavelength with a microplate reader; see the test results image 3 a.

[0055] Such as image 3 As shown in A, compared with the control group, the proliferation ability of mouse cells was significantly reduced after OGT knockout.

[0056] 2. Apoptosis detection

[0057] Flow cytometry was use...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of OGT as a target in preparation of a medicine for treating abnormal secretion of glucagon in diabetes. The medicine is a medicine for inhibiting expression of O-GlcNAc glycosyltransferase OGT, wherein the functional component can be at least one of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA / DNA, a low molecular compound, peptide and an antibody. Studies find that the secretion amount of glucagon can be reduced by knocking out or inhibiting O-GlcNAc glycosyltransferase OGT, meanwhile, withering of islet alpha cells can be promoted, proliferation of the islet alpha cells is inhibited, and O-GlcNAc glycosyltransferase OGT can be used as a target for treating diabetes.

Description

technical field [0001] The invention belongs to the technical field of biology, and specifically relates to an application of OGT as a target in the preparation of drugs for treating abnormal secretion of glucagon in diabetes. Background technique [0002] Diabetes mellitus (DM) is an endocrine and metabolic disease characterized by hyperglycemia, and it is also a lifelong disease that can affect the organs of the whole body. According to the estimates of the World Health Organization (WHO), the total number of diabetic patients in the world has exceeded 130 million, and will exceed 300 million in 2025. In just 30 years from 1980 to 2010, the prevalence of diabetes in China also rose from 0.9% to 11.6%, becoming the country with the most diabetic patients in the world. By 2017, 1 out of every 4 diabetic patients in the world came from China. Long-term high blood sugar in the body can lead to chronic damage and dysfunction of multiple tissues and organs, such as the heart, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61P3/10C12Q1/6883C12N15/11
CPCA61K45/00A61P3/10C12Q1/6883C12Q2600/158
Inventor 田梗徐玉雪彭越吴晓俊綦翔宇
Owner BINZHOU MEDICAL COLLEGE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com