Construction method and application of Nur77 GFP Jurkat report cell line
A cell line and reporting technology, applied in DNA/RNA fragments, animal cells, vertebrate cells, etc., which can solve problems such as high cost, high risk, and inability to screen and optimize CAR sequences early
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: sgRNA screening
[0030] sgRNA design and synthesis
[0031]In order to more efficiently recombine a piece of exogenous gene GFP before the stop codon of Nur77 to directly reflect the gene expression of NUR77, CRISPR gene editing technology was used to improve the efficiency of gene recombination. The sgRNA design was carried out through the online sgRNA design website https: / / zlab.bio / guide-design-resources, and the sgRNA sequence is shown in Table 1. Put all the sgRNA sequences generated by the website (indicated by XXXXXXXXXXXXXXXXXXXX) into the sgRNA backbone sequence 5'TTCTAATACG ACTCACTATA XXXXXXXXXXXXXXXXXXXX GTTTTAGAG CTAGAAATAG CAAGTTAAAATAAGGCTAGT CCGTTATATCAA CTTGAAAAAG TGGCACCGAG TCGGTGCTTT T3 ' Use the NEB T7 transcription kit to transcribe into functional sgRNA. The transcribed sgRNA sequence is 5′ GUGCAACCUUCAUUUCCCUGCYYYYYYYYYYYYYYYYYYYYAAUAGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU 3′
[0032] Table 1. Nur77 exon 8 sgRN...
Embodiment 2
[0038] Embodiment 2: exogenous DNA template (donor DNA) vector construction
[0039] PCR of the left homology arm fragment: using Jurkat T cell DNA as a template, add the left homology arm forward primer LHA_fwd: atccccgggtaccgagctcgGATCCTCCTGTCTCAGCCTC, and reverse primer Mut-LHA-R2: ctccggagccGAAGGGCAGCGTGTCCATGAAGATCTTGTCAAT GATTGGCGGCGGTGGCACCAAGTCCTCCAGCTTG for PCR with TOYOBO high-fidelity KODFX kit , to obtain the 880bp left homology arm fragment.
[0040] Exogenous insert fragment P2A-GFP fragment PCR: use the plasmid pCCL-luciferase-P2A-GFP containing P2A-GFP as a template, add forward primer GFP_fwd: gctgcccttcGGCTCCGGAGAGGGACGG reverse primer GFP_rev: caggcaggggTTACTTGTACAGCTCGTCCATGCC, use TOYOBO high-fidelity KOD FX kit By PCR, a 783bp P2A-GFP fragment was obtained.
[0041] Right homology arm fragment PCR: using Jurkat T cell DNA as a template, add right homology arm forward primer RHA_fwd: gtacaagtaaCCCCTGCCTGGGAACACG, and reverse primer RHA_rev: ttgtaaaacgacgg...
Embodiment 3
[0047] Example 3. Jurkat Nur77-GFP cell line construction
[0048] 1) RNP and donor DNA delivery: Mix 250ng N8-9sgRNA and 1μg Cas9 protein and incubate at room temperature for 15min to form RNP; then add 1μg donor DNA, use Thermo Fisher Neon electroporation instrument, follow neon electroporation parameters 1700V / 10ms / 3 pulses In the electroporation method, the mixture of RNP and donor DNA was electroporated into 5*10^5 JurkatT cells. Immediately after electroporation, the cells were transferred to a preheated 24-well plate and cultured in medium for 72 h.
[0049] 2) Detection of Nur77-GFP functional expression in cell pool: CD3 signaling pathway can activate Jurkar T and promote Nur77 expression. Since Nur77 and GFP share the Nur77 promoter, only cells with correct recombination will produce GFP signal, and the degree of GFP expression also represents Nur77 expression levels. 72 hours after electroporation, CD3 antibody OKT3 was added to 4*10^5 cells, and the final concent...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More