Primate animal DNA methylation relative quantification kit
A primate, relative quantification technology, applied in the field of primate DNA methylation relative quantification kit, can solve problems such as easy to cause pollution, affect the actual quantification of the target, and cumbersome process, so as to avoid instability or genome Effects of DNA contamination
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] In the following examples, the assay was run on a fluorescent quantitative PCR detection platform to detect the methylation level of target genes in plasma cell-free DNA. Fluorescent quantitative PCR detection was performed on the Lightcycle480 platform.
[0081] 1. Foreign DNA
[0082] Virus (double-stranded DNA virus): Lambda bacteriophage DNA, DNA was purchased from NEB (Cat. No.: N3011L).
[0083] Plasmid synthesis: Synthesize DNA fragments without CG sites (plasmid synthesis, the vector is PUC57, and the host strain is DH5a), and the plasmid enzyme is used to cut into linear lines.
[0084]Zebrafish embryos, larvae, juveniles, and adults were purchased from Suzhou Murui Biotechnology Co., Ltd. For DNA extraction, the embryos (larvae, juveniles, or tail fins cut into pieces) were homogenized with a tissue homogenizer, and then DNeasy Blood & Tissue Kit (QIAGEN, catalog number: 69582) was used to extract DNA.
[0085] The mice were purchased from Suzhou Hengxinche...
Embodiment 2
[0098] Example 2 Detecting the Amplification of Targets in Different Exogenous DNAs
[0099] Take 20ng of exogenous DNA, after bisulfite conversion, investigate the amplification of several common targets (septin9, SDC2, SHOX2 and NDRG4) in several cancer researches in exogenous bisDNA (Bisulfite conversion DNA), which needs to meet The requirement that the detection target is not amplified in exogenous DNA. See Example 1 for the DNA conversion operation, and a double PCR system was used for PCR detection.
[0100] 1. Septin9 detection region and primers and probes
[0101] Detection region - DNA original sequence
[0102] TGGCTGCTGCGGCCGCGGACGTGCTGGAGAGGACCCTGCGGGTGGGCCTGGCGCGGGACGGGGGTGCGCTGAGGGGAGACGGGAGTGCGCTGAGGGGAGACGGGACCCCTAATCCAGGCGCCCTCCCGCTGAGAGCGCCGCGCGCCCCCGGCCCCGTGCCCGCGCCGCCTACGTGGGGGACCCTGTTAGGGGCACCCGCG
[0103] Detection region - sequence after bisulfite conversion
[0104] TGGTTGTTGCGGTCGCGGACGTGTTGGAGAGGATTTTGCGGGTGGGTTTGGCGCGGGACGGGGGTGCGTTGAGGGGAGACGG...
Embodiment 3
[0173] Example 3 After the exogenous DNA was treated with bisulfite, the PCR detection of the selected exogenous internal reference fragment
[0174] Take 20ng, 200ng and 2μg exogenous DR amplification. See Example 1 for the DNA transformation operation, and a triple PCR system was used for PCR detection. The amplification results of phage and plasmid are shown in Table 4, and the amplification results of zebrafish are shown in Table 5.
[0175] Table 4 Amplification of exogenous DNA (phage DNA and plasmid) after bisulfite transformation
[0176]
[0177] λ phage detection fragment: Considering that the methylation status of the virus is different from that of eukaryotes, the selected detection fragment does not include the CG site
[0178] Lambda Phage Detection Fragment 1
[0179] original sequence
[0180] TCTTTCTGATTTAATAATAGATGATTCAGTTAAATATGAAGGTAATTTCTTTTGTGCAAGTCTGACTAACTTTTTTTATACCAATGTTTAACATACTTTCATTTGTAATAAACTCAATGTCATTTTCTTCAATGTAAGATGAAATAAGAGTAGCCTTTGCCT ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


