Primate animal DNA methylation relative quantification kit

A primate, relative quantification technology, applied in the field of primate DNA methylation relative quantification kit, can solve problems such as easy to cause pollution, affect the actual quantification of the target, and cumbersome process, so as to avoid instability or genome Effects of DNA contamination

Active Publication Date: 2021-06-25
JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD
View PDF35 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] For the quantitative detection of methylation of trace DNA (such as plasma free ctDNA, etc.), if the pre-amplification method is used, the process is cumbersome in practical applications, requiring two-step PCR, and the first PCR product needs to be uncapped and diluted. If the relative quantitative method is used, the current research method uses ACTB as an internal reference, and the level of ACTB is easily affected by external or internal sources, which will affect the actual quantification of the target.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primate animal DNA methylation relative quantification kit
  • Primate animal DNA methylation relative quantification kit
  • Primate animal DNA methylation relative quantification kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] In the following examples, the assay was run on a fluorescent quantitative PCR detection platform to detect the methylation level of target genes in plasma cell-free DNA. Fluorescent quantitative PCR detection was performed on the Lightcycle480 platform.

[0081] 1. Foreign DNA

[0082] Virus (double-stranded DNA virus): Lambda bacteriophage DNA, DNA was purchased from NEB (Cat. No.: N3011L).

[0083] Plasmid synthesis: Synthesize DNA fragments without CG sites (plasmid synthesis, the vector is PUC57, and the host strain is DH5a), and the plasmid enzyme is used to cut into linear lines.

[0084]Zebrafish embryos, larvae, juveniles, and adults were purchased from Suzhou Murui Biotechnology Co., Ltd. For DNA extraction, the embryos (larvae, juveniles, or tail fins cut into pieces) were homogenized with a tissue homogenizer, and then DNeasy Blood & Tissue Kit (QIAGEN, catalog number: 69582) was used to extract DNA.

[0085] The mice were purchased from Suzhou Hengxinche...

Embodiment 2

[0098] Example 2 Detecting the Amplification of Targets in Different Exogenous DNAs

[0099] Take 20ng of exogenous DNA, after bisulfite conversion, investigate the amplification of several common targets (septin9, SDC2, SHOX2 and NDRG4) in several cancer researches in exogenous bisDNA (Bisulfite conversion DNA), which needs to meet The requirement that the detection target is not amplified in exogenous DNA. See Example 1 for the DNA conversion operation, and a double PCR system was used for PCR detection.

[0100] 1. Septin9 detection region and primers and probes

[0101] Detection region - DNA original sequence

[0102] TGGCTGCTGCGGCCGCGGACGTGCTGGAGAGGACCCTGCGGGTGGGCCTGGCGCGGGACGGGGGTGCGCTGAGGGGAGACGGGAGTGCGCTGAGGGGAGACGGGACCCCTAATCCAGGCGCCCTCCCGCTGAGAGCGCCGCGCGCCCCCGGCCCCGTGCCCGCGCCGCCTACGTGGGGGACCCTGTTAGGGGCACCCGCG

[0103] Detection region - sequence after bisulfite conversion

[0104] TGGTTGTTGCGGTCGCGGACGTGTTGGAGAGGATTTTGCGGGTGGGTTTGGCGCGGGACGGGGGTGCGTTGAGGGGAGACGG...

Embodiment 3

[0173] Example 3 After the exogenous DNA was treated with bisulfite, the PCR detection of the selected exogenous internal reference fragment

[0174] Take 20ng, 200ng and 2μg exogenous DR amplification. See Example 1 for the DNA transformation operation, and a triple PCR system was used for PCR detection. The amplification results of phage and plasmid are shown in Table 4, and the amplification results of zebrafish are shown in Table 5.

[0175] Table 4 Amplification of exogenous DNA (phage DNA and plasmid) after bisulfite transformation

[0176]

[0177] λ phage detection fragment: Considering that the methylation status of the virus is different from that of eukaryotes, the selected detection fragment does not include the CG site

[0178] Lambda Phage Detection Fragment 1

[0179] original sequence

[0180] TCTTTCTGATTTAATAATAGATGATTCAGTTAAATATGAAGGTAATTTCTTTTGTGCAAGTCTGACTAACTTTTTTTATACCAATGTTTAACATACTTTCATTTGTAATAAACTCAATGTCATTTTCTTCAATGTAAGATGAAATAAGAGTAGCCTTTGCCT ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology, in particular to a primate animal DNA methylation relative quantification kit. The kit comprises: a) a juvenile zebrafish DNA or zebrafish DNA without CpG site, and b) a DNA quantitative detection reagent which at least comprises a reagent for quantitative detection of a), wherein the juvenile zebrafish is zebrafish from fertilized egg formation to development within 120 hours. According to the kit, accurate quantification of DNA methylation of primates can be realized, and the problem that endogenous internal reference is prone to instability or genome DNA pollution caused by own factors or sample collection reasons is solved.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a kit for relative quantification of primate DNA methylation. Background technique [0002] Most of the current studies on the methylation level of specific genes or specific DNA sequences are based on bisulfite conversion methods. After bisulfite conversion, the methylation level can be detected by sequencing, PCR, digital PCR, restriction enzyme digestion, chip and other methods. In actual clinical application and detection kit development, the most widely used method is the PCR method. [0003] The PCR method is used for the quantitative study of methylation. Absolute quantitative methods are usually used when there is a large amount of initial DNA (such as tissue-derived DNA or exfoliated cell DNA, etc.); trace DNA (such as plasma free ctDNA, etc.) Amplification method, the number of cycles of pre-amplification PCR is usually more than 30 cycles: after the pre-amplification...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6858C12Q1/6806
CPCC12Q1/6806C12Q1/6858C12Q2531/113C12Q2537/143C12Q2523/125C12Q2545/101C12Q2545/113C12Q2563/107
Inventor巴兆粉于薇穆文磊陆艳陆志恒王弢
OwnerJIANGSU MICRODIAG BIOMEDICINE TECH CO LTD