A kind of caix-car-t cell driven by hvem co-stimulatory signal and its preparation method and application
A cell and signal transduction technology, applied in the field of biomedicine, can solve problems such as no breakthrough in clinical efficacy, and achieve good clinical application prospects and good therapeutic effects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0122] Example 1 Preparation of CAR-T cells
[0123] 1. Construction of CAR expression plasmid
[0124] Add restriction site Nde I (CATATG), start codon (ATG), hCD8 signal peptide (SP) (GCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCG) and C at the 5' end of CAIX(5C9B7)-HVEM-CAR coding DNA sequence in sequence - the DNA sequence of the myc tag (GAGCAGAAGCTGATCAGCGAGGAGGACCTG), the DNA sequence of the stop codon (TAA) and the restriction endonuclease Spe I (ACTAGT) are sequentially added at the 3' end. The above DNA sequence was encoded by total gene synthesis. The synthetic DNA fragment was inserted into the lentiviral vector pRRL through the restriction endonuclease sites Nde I and Spe I to construct the pRRL-CAIX(5C9B7)-HVEM-CAR expression plasmid.
[0125] The combination sequence (from N-terminal to C-terminal) of each element of the chimeric antigen receptor in the pRRL-CAIX(5C9B7)-HVEM-CAR expression plasmid constructed in the present invention is as follow...
Embodiment 2
[0173] Example 2 Detecting the ability of CAR-T cells to release cytokines under normoxic conditions
[0174] In this example, an ELISA experiment was used to detect the release of cytokines of CAR-T cells. Human renal cancer cells Ketr-3, OSRC-2, ACHN and 293T cells are preserved in the laboratory of the inventor of the present invention. Ketr-3, ACHN and 293T cells were cultured in DMEM medium containing 10% FBS after recovery, and OSRC-2 cells were cultured in RPMI-1640 medium containing 10% FBS after recovery at 37°C, 5% CO 2 cultured in an incubator.
[0175] 1. Cell supernatant collection
[0176] (1) Collect target cells OSRC-2, Ketr-3, ACHN, adjust the concentration to 1×10 5 / mL;
[0177] (2) Collect the Ctrl-T cells and CAIX-CAR-T cells cultured to the 10th day, and adjust the concentration to 1×10 5 / mL;
[0178] (3) Take a U-bottom 96-well plate, add 100 μL target cell suspension and 100 μL effector cell suspension to each well, and place in a 37°C incubator ...
Embodiment 3
[0207] Example 3 Detection of the killing effect of CAR-T cells on target cells under normoxic conditions
[0208] In order to explore the killing function of CAIX-HVEM-CAR-T cells, this example first analyzed the killing ability of CAR-T cells on target cells in real time by RTCA (Real Time Cellular Analysis). In order to further study the killing function of CAIX-HVEM-CAR-T cells, this study also used flow cytometry to detect the killing effect of CAIX-HVEM-CAR-T cells on renal cancer cells.
[0209] 1. Experimental method
[0210] (1) Add 50 μL of the complete medium used for target cell culture to each well of the E-Plate detection plate of the xCELLigence cell function analyzer to determine the background impedance value;
[0211] (2) Collect the target cells in the logarithmic growth phase and adjust the cell suspension to a concentration of 1×10 5 / mL, and then add 100 μL of target cell suspension (equivalent to 10 4 target cells per well), and placed in the incubato...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More