Blocking ELISA antibody detection kit based on EHDV core-like particles, preparation method and application
An antibody detection and kit technology is applied in the field of deer epidemic hemorrhagic fever virus blocking ELISA antibody detection kits, which can solve problems such as the impact of ruminant breeding industry, improve sensitivity and specificity, avoid virus spread, improve Effects of sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0065] Preparation and purification of example 1 EHDV core-like particles
[0066] (1) Construction of recombinant bacmid Bacmid-vp3-vp7
[0067] By subcloning, the EHDV vp3 gene (SEQ ID NO.1) and vp7 gene (SEQ ID NO.2) were sequentially inserted into the vector pFastBac TM Dual, to construct the recombinant plasmid pFastBac-Dual-vp3-vp7, see its structure figure 1 . The recombinant plasmid pFastBac-Dual-vp3-vp7 with correct sequencing was transformed into DH10Bac, and the recombinant bacmid-vp3-vp7 was obtained by screening by blue-white spot and colony PCR.
[0068] Said SEQ ID NO.1 is as follows:
[0069]ATGGCAGATCCACCAGATGCAAATGCACCAAAAACGAGTCCGTATCTAAAAGGAGATGAGTTATCAAGTGACAGTGGACCTTTGCTTTCAATCTTCGCTCTACAAGAGATTATGCAAAAGGTGCGACAAGCGCAATCGGAGTATGTTGCAGCAACTAAAGATGTCGATCTAACGGTACCGGATGTTCAAAAAATAATCGATGGAGTTAAAGAGCTGGCCTCAGAGACGATCTATAAAATTGTACAGAAACCCATCATCTCGTATAGGCATGTGGTGATGCAATCAAGGGATAGATTTCTCCGGGTGGACACCTATTATGAAAGGATGTCTGAAGTTGGCGATAAGATAGATGAGAATGAACCCGCGAAATTT...
example 2
[0078] Example 2 Establishment of a blocking ELISA method based on EHDV core-like particles
[0079] (1) Determination of the most suitable coating solution
[0080] The difficulty in establishing an ELISA method using EHDV CLPs as a coating antigen is that the coating process must ensure that the morphological structure of EHDV CLPs is not damaged by the coating solution. For this reason, the present invention is to determine the most suitable coating liquid, coating liquid is respectively set to the bicarbonate buffer (CB) of 0.05M pH9.6, the hydrogen phosphate buffer (PBS) of 0.2M pH7.4 , 0.2M pH8.0 Tris hydrochloric acid buffer (TB) and 0.1M pH8.0 Tris hydrochloric acid buffer, the purified EHDVCLPs were diluted with these buffers, and the particle morphology was observed under a transmission electron microscope. Results (see Figure 5 ) showed that after dilution with 0.05M pH9.6 bicarbonate buffer (CB) as the coating solution, the structure of EHDV CLPs was completely ...
example 3
[0111] Determination results of the critical value of Example 3
[0112] Detect 80 known EHDV-negative sera according to the established blocking ELISA operating procedure, and read the OD 450nm Value, the results were statistically analyzed to calculate the average blocking rate of serum samples is 10.5%, and the standard deviation (s) is 4.62%,
[0113] When the blocking rate PI≥24.36%, it is judged as positive,
[0114] When the blocking rate PI≤19.74%, it is judged as negative,
[0115] When the blocking rate is 19.74%
[0116] The test needs to be repeated once, and if it is still lower than 24.36%, it is judged as negative for serum antibodies.
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com