Unlock instant, AI-driven research and patent intelligence for your innovation.

Method of modulating the alkaloid content of a plant

An alkaloid and plant technology, which is applied in the fields of regulating the expression and/or activity of polypeptides encoded by genes, regulating polypeptide constructs, smoking products, regulating gene expression and/or activity, and can solve the problems of complex alkaloid content, etc.

Pending Publication Date: 2021-08-06
BRITISH AMERICAN TOBACCO (INVESTMENTS) LTD
View PDF20 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Regulation of alkaloid content in tobacco is complex

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of modulating the alkaloid content of a plant
  • Method of modulating the alkaloid content of a plant
  • Method of modulating the alkaloid content of a plant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0503] Example 1 - Transient overexpression of protein kinases reduces alkaloid content in leaves

[0504] Methods and Materials

[0505] clone

[0506] protein kinase expression vector

[0507] The gene sequence (SEQ ID No. 1) was amplified from a Gateway™ compatible cDNA library using primers located outside of the restriction sites flanking the gene sequence. The gene sequence is then transferred to an expression vector.

[0508] The resulting plasmid was sequenced and transformed by heat shock into Agrobacterium tumefaciens GV3101 pMP90 and transiently expressed in TN90 leaves.

[0509] transient gene expression

[0510] Agrobacterium tumefaciens GV3101 strains carrying the construct of interest were grown overnight in Luria-Bertani (LB) medium supplemented with appropriate antibiotics. The culture was spin down and resuspended to OD600 in a buffer containing 10 mMMgCl2, 10 mM 2-(N-morpholino)ethanesulfonic acid (MES) pH 5.6 and 100 µM acetosyringone =0.6 and incub...

Embodiment 2

[0523] Example 2 - Virus-induced gene silencing (VIGS) of protein kinases increases alkaloid content in leaves

[0524] Virus-induced gene silencing (VIGS)

[0525] For virus-induced gene silencing, a 248-nucleotide cDNA fragment was synthesized and the following primers were used: Nitab4.5_0003679g0060.2_InFusion 5' TGAGTAAGGTTACCGAATTC (SEQ ID No. 5); and Nitab4.5_0003679g0060.2_InFusion 3' CTCGAGGCCCGGGCATGTCC (SEQ ID No. 6), using the In-Fusion cloning kit to clone into pTV00 (between EcoRI and XhoI sites) to form TRV2-Nitab4.5_0003679g0060.2.

[0526] The plasmid was then transformed into Agrobacterium tumefaciens GV3101.

[0527] 248-nucleotide cDNA fragment SEQ ID No. 4.

[0528] TRV vectors containing both (TRV RNA1 ) and (TRV RNA2 ) containing the targeted nucleotide sequence were propagated separately in Agrobacterium tumefaciens. These cultures were mixed (1:1) and syringe infiltrated into 2-week old TN90 plants. Silencing effects were assessed five weeks after ...

Embodiment 3

[0532] Example 3 - Protein Kinase Activity

[0533] The wild-type protein kinase (having the amino acid sequence shown in SEQ ID No. 3) and the kinase-inactive form (K308M variant) having a mutation at amino acid residue 308 of SEQ ID NO. 3 were transformed into Rosetta 2 (DE3 ) cells and plated on LB plates supplemented with appropriate antibiotics.

[0534] Cultures prepared from single colonies were grown until OD600 = 0.3-0.4. The culture was then moved to the relative induction temperature (37 °C). When the cultures had reached an OD600 of 0.6-0.8, they were induced with 0.5 mM IPTG for 3 hours. Cells were harvested by centrifugation at 4000 rpm for 20 minutes at 4°C. By pipetting in 2 ml lysis buffer (25 mM HEPES pH7.5, 0.2 M NaCl, 1 mM DTT, 1 mM EDTA, 0.2 mM PMSF, 1 mg / ml lysozyme, 0.01 U / µl Benzonase, protease inhibitors), the The pellet was resuspended, then freeze-thawed at -80°C and centrifuged at 20k x g for 30 minutes. The supernatant was then diluted 1 / 2 i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a method for modulating the alkaloid content of a plant (e.g. a tobacco plant), the method comprising modifying said plant by modulating the activity or expression of at least one protein kinase. The present invention also provides for the use of at least protein kinase gene for modulating the alkaloid content of a plant, as well as tobacco cells, plants, plant propagation materials, harvested leaves, processed tobaccos, or tobacco products obtainable in accordance with the invention.

Description

technical field [0001] The present invention relates to methods of modulating the alkaloid content, such as nicotine content, of plants or parts thereof. The invention also extends to methods of modulating the expression and / or activity of polypeptides encoded by genes that regulate alkaloid content in plants. In another aspect, the invention provides methods of modulating the expression and / or activity of a gene encoding a polypeptide that modulates alkaloid content in a plant. The invention also extends to constructs that can be used to modulate the polypeptides, plant cells transformed with such constructs, and the transgenic plants themselves. The invention also relates to the use of leaves harvested from such transgenic plants transformed with a genetic construct for modulating alkaloid content, and smoking articles (eg combustible smoking articles) comprising such leaves. Background technique [0002] Alkaloids are a group of naturally occurring compounds that mainly...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12C12N15/82A01H6/82
CPCC12N9/1205C12N15/8243A01H6/823A24B15/16C12Y207/11001C07K14/415
Inventor S·本哈立德F·阿纳斯塔乔德阿布罗埃利马
Owner BRITISH AMERICAN TOBACCO (INVESTMENTS) LTD