Construction method and application of saccharomyces cerevisiae for producing cembratrienol

A technology of cerebrotrienol and cerebrotrienol synthase, which is applied in the fields of metabolic engineering and microbial engineering, and can solve problems such as unfavorable production of cerebrotrienol and the like

Pending Publication Date: 2021-09-14
JIANGNAN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, a single recombinant strain construction method is not conducive to the efficient industrial production of cembratriene-ol by recombinant microorganisms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of saccharomyces cerevisiae for producing cembratrienol
  • Construction method and application of saccharomyces cerevisiae for producing cembratrienol
  • Construction method and application of saccharomyces cerevisiae for producing cembratrienol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] The plasmid pY26TEF-GPD was used to heterologously express the GGPP synthase gene ggpps and the cembratrienol synthase gene cbts to realize the synthesis of cembratrienol in S. cerevisiae W303-1A. The specific construction method is as follows: use primer ggpp_tc_fusion_FW: CGGGATCCATGGCTTATACTGCTATGGCT;

[0036] ggpp_tc_fusion_RS: TGATAATGATAAACTGAGCTTTAATTTTGTCTAAAAGCGA;

[0037] GAP_g_G_t__FW: GTCGAATCTGTCGACATATGAGAGGGTTAATTGCGCGCCG;

[0038] g_G_t_fusion_2_RS: CGGCGCGCAATTAACCCTCTCATATGTCGACAGATTCGA.

[0039] Combine ggpps with the promoter P shown in promoter SEQ ID NO.7 GAP , the gene cbts shown in SEQ ID NO.2 is fused to PCR, digested with restriction endonucleases Bam HI and EcoRI, and then connected to the plasmid pY26TEF-GPD to obtain the recombinant plasmid pY26TEF-GPD-ggpps-P GAP-cbts. Then the recombinant plasmid pY26TEF-GPD-ggpps-P GAP -cbts were transformed into S.cerevisiae W303-1A to obtain recombinant strain S19.

[0040] A single colony of the ...

Embodiment 2

[0043] In this example, the cembratrienol synthase gene cbts and the farnesyl pyrophosphate synthase gene erg20 were expressed in tandem to construct a recombinant strain S21. The specific construction method is as follows: using primers

[0044] ERG20-1-FW:ATGGCATATACTGCAATGGCG;

[0045] ERG20-1-RS:TTAATTTTGTCTGAACGCGAT,

[0046] The gene ERG20 shown in SEQ ID NO.6 was amplified from the Saccharomyces cerevisiae genome, cloned in one step, and connected to the recombinant plasmid pY26TEF-GPD-ggpps-P constructed in Example 1 GAP -The 3' end of the gene cbts of cbts, obtain the recombinant plasmid pY26TEF-GPD-ggpps-P GAP -cbts-erg20. Then the recombinant plasmid pY26TEF-GPD-ggpps-P GAP -cbts-erg20 was transformed into S.cerevisiae W303-1A to obtain recombinant strain S21.

[0047] A single colony of the recombinant strain S21 was inserted into 20 mL of fresh YPD medium, and cultured in a shake flask at 30° C. and 200 rpm for 12 hours. Then the seed liquid was transferred ...

Embodiment 3

[0050] In this example, different S. cerevisiae host strains (S. cerevisiae BY4741) were used to produce cembratriene-ol. The recombinant plasmid pY26TEF-GPD-ggpps-P constructed and obtained in Example 2 GAP -cbts-erg20 was transformed into the strain S.cerevisiae BY4741, and the recombinant strain S22 was constructed. The cultivation method is the same as in Example 2.

[0051] Such as image 3 As shown, the cembratriene-ol production of the recombinant strain S22 was 9.5 μg / L, the conversion rate was 0.48 μg / g, and the production intensity was 1.32×10 -1 μg / (L·h), compared with the strain S21 yield that embodiment 2 constructs has significantly improved. The production of cembratrienol in strain S22 was 1.39 times higher than that in S21, which may be related to the growth of strain S.cerevisiae BY4741. It shows that S.cerevisiae BY4741 is more suitable for the production of cembratriene-ol than S.cerevisiae W303-1A.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method and application of saccharomyces cerevisiae for producing cembratrienol, and belongs to the field of metabolic engineering and microbial engineering. According to the method, two key enzymes, namely geranyl pyrophosphate synthase gene gpps and cembratrienol synthase gene cbts, synthesized by cembratrienol are heterologously expressed in the saccharomyces cerevisiae W303-1A, so that the production of the cembratrienol in the saccharomyces cerevisiae is realized from the source; furthermore, through tandem overexpression of a key enzyme farnesyl pyrophosphate synthetase (ERG20) with the cembratrienol synthase gene cbts, the yield of cembratrienol of the obtained recombinant strain is remarkably improved. The way is constructed into the saccharomyces cerevisiae BY4741, and the yield of cembratrienol is increased to 3 times of that of a control strain. A promoter is added in front of the key enzyme farnesyl pyrophosphate synthase gene, so that the yield of cembratrienol of the recombinant saccharomyces cerevisiae is further improved.

Description

technical field [0001] The invention relates to a construction method and application of cembratrienol-producing Saccharomyces cerevisiae, belonging to the fields of metabolic engineering and microbial engineering. Background technique [0002] In the context of the global insecticide market, chemically synthesized active compounds such as artificial pyrethrum derivatives and most notably neonicotinoids (e.g. imidacloprid, thiamethoxam and clothianidin; valued at US$ 1.89 billion), which can Fast-acting pest but non-target discriminant product. Neonicotinoids are the main class of insecticides that mediate the neurotoxic effects of all insects through irreversible binding to nicotinic acetylcholine receptors. Chemical pesticides have many disadvantages, such as: easy to cause environmental pollution, target populations gradually develop resistance, and they have negative effects on non-target populations. These compounds thus affect pests as well as beneficial insects such...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N9/88C12N9/10C12N15/54C12N15/60C12N15/81C12P7/02C12R1/865
CPCC12N9/88C12N9/1085C12N15/81C12P7/02C12Y205/0101C12Y205/01029
Inventor陈献忠杨海泉张坤杰刘万隆董田田沈微夏媛媛陈磊曹钰
OwnerJIANGNAN UNIV