Supercharge Your Innovation With Domain-Expert AI Agents!

Sinorhizobium fredii HH103 omega mutant and application thereof

A technology of mutants and rhizobia, applied in the field of agricultural microorganisms, can solve problems such as the difficulty in controlling the number of soybean root nodules

Active Publication Date: 2021-09-14
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to reduce the number of nodules on the premise of reducing labor costs, and solve the technical problem that it is difficult to control the number of soybean nodules

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sinorhizobium fredii HH103 omega mutant and application thereof
  • Sinorhizobium fredii HH103 omega mutant and application thereof
  • Sinorhizobium fredii HH103 omega mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1. Construction of recombinant vectors

[0037]1. According to the complete genome sequence of Sinorhizobium fredii (Sinorhizobium fredii) HH103 (NCBI ID number is txid1117943), find the coding sequence of type III effector NopZ (GenBank: AY683479.1). Design the NopZ mutant fragment sequence (about 650bp upstream and 750bp downstream of the start codon), and design primers NopZ mutant fragment-F (CCGTGCGATAGTTGTGGTT, SEQ ID NO: 1) and NopZ mutant fragment-R (TCACCTCCCAAATCCCAAA, SEQ ID NO: 2).

[0038] 2. NopZ mutant fragment: the genome of Rhizobium HH103 was extracted using the Bacterial Whole Genome Extraction Kit (TIANGEN Company), and the NopZ mutant fragment of the extracted Rhizobium HH103 genome was carried out using primers NopZ mutant fragment-F and NopZ mutant fragment-R. PCR amplification. Reaction system: Template DNA, 2μg; 5×PS Bufferr, 20μL; dNTP, 8μL; NopZ-R, 2μL; NopZ-F, 2μg; PrimeSTAR, 1.2μL; ddH2O, up to 100μL;

[0039] Reaction conditions (...

Embodiment 2

[0054] Embodiment 2. Construct the mutant of Rhizobium HH103

[0055] 1. Triparental hybridization experiment method: Streak the Escherichia coli with pJQ200SK-NopZ on the LB solid medium containing Km and Gent resistance; streak the wild-type rhizobia HH103 on the TY solid medium containing Rif resistance Middle; Escherichia coli carrying the Helper plasmid was streaked on LB solid medium containing Km resistance. Cultivate overnight until a single clone grows; culture the three bacterial clones in 7mL of the corresponding medium to OD 600 The value is about 0.65; each pipette 1mL into a new 1.5mL centrifuge tube, centrifuge at 12 000rpm for 30s at room temperature, discard the supernatant, and resuspend repeatedly with 1mL anti-TY (adjust OD600 to 0.6); Take 200 μL of the resuspended HH103 bacterial solution, 100 μL each of pJQ200SK-NopZ Escherichia coli and Escherichia coli with Helper plasmid into a new 1.5mL centrifuge tube, centrifuge at 11995rpm for 30s, discard the su...

Embodiment 3

[0064] Example 3. Construction of anaplerotic strain pFAJ1702-NopZ and identification of nodulation ability

[0065] 1. Design primers: start at about 500 bp before the NopZ start codon and end at NopZ as the amplified fragment. Use DNAMAN to analyze enzymes that cannot cut HindⅢ, BamHI, and design primers. pFAJ1702-NopZ-F (CCCAAGCTTCGTGCGATGCGCGAGATA, SEQ ID NO: 11), pFAJ1702-NopZ-R (CGCGGATCCTTACCGGAACTCGTTGCG, SEQ ID NO: 12).

[0066] The steps are: (1) Use pFAJ1702-NopZ(F / R) to amplify the whole genome of Sinorhizobium HH103, after purifying the product, carry out double enzyme digestion of the vector and NopZ target product for 3-5 hours, perform product purification after enzyme digestion, and ligate for 16 hours After that, it was transferred into Escherichia coli, and the bacterial solution was sequenced after PCR verification;

[0067] (2) An anaplerotic strain of NopZ was obtained by three-parent hybridization, and the anaplerotic strain was named HH103ΩNopZpFAJ1702-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Sinorhizobium fredii HH103 omega mutant and application thereof, and belongs to the technical field of agricultural microorganisms. The invention aims to reduce the number of soybean root nodules. The invention provides a mutant of Sinorhizobium fredii HH103; the mutant takes the Sinorhizobium fredii HH103 as an original strain; and several times of experiments and verification of different populations show that the mutant HH103 Omega NopZ with NopZ mutation can reduce the number of the soybean root nodules, so that a foundation is provided for subsequent research on formation of a soybean-Sinorhizobium fredii symbiotic system, and the possibility is provided for improving the symbiotic efficiency of soybeans and Sinorhizobium fredii.

Description

technical field [0001] The invention belongs to the technical field of agricultural microorganisms, and in particular relates to a rhizobium HH103Ω mutant and application thereof. Background technique [0002] Nitrogen is one of the most important elements that limit the growth of crops, but the nitrogen in the soil that can be used by plants is very limited, and it is mainly provided by chemical fertilizers. However, with the continuous increase of nitrogen fertilizer application, it not only inhibits the symbiotic nitrogen fixation between rhizobia and leguminous plants, but also brings many adverse effects on the ecological environment. Therefore, in the absence of chemical fertilizer supply, symbiotic nitrogen fixation can provide a sufficient nitrogen source for the growth and development of legumes. After the soybean root system is infected by rhizobia, symbiotic root nodules will be formed, and the root nodules will convert nitrogen in the air into ammonia through bi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12N15/64A01G7/06A01G22/40C12R1/41
CPCC12N1/20C07K14/415A01G7/06A01G22/40
Inventor 辛大伟王锦辉刘春燕邹佳男杨明亮朱荣胜胡振帮武小霞齐照明赵莹陈庆山
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com