Sinorhizobium fredii HH103 omega mutant and application thereof
A technology of mutants and rhizobia, applied in the field of agricultural microorganisms, can solve problems such as the difficulty in controlling the number of soybean root nodules
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1. Construction of recombinant vectors
[0037]1. According to the complete genome sequence of Sinorhizobium fredii (Sinorhizobium fredii) HH103 (NCBI ID number is txid1117943), find the coding sequence of type III effector NopZ (GenBank: AY683479.1). Design the NopZ mutant fragment sequence (about 650bp upstream and 750bp downstream of the start codon), and design primers NopZ mutant fragment-F (CCGTGCGATAGTTGTGGTT, SEQ ID NO: 1) and NopZ mutant fragment-R (TCACCTCCCAAATCCCAAA, SEQ ID NO: 2).
[0038] 2. NopZ mutant fragment: the genome of Rhizobium HH103 was extracted using the Bacterial Whole Genome Extraction Kit (TIANGEN Company), and the NopZ mutant fragment of the extracted Rhizobium HH103 genome was carried out using primers NopZ mutant fragment-F and NopZ mutant fragment-R. PCR amplification. Reaction system: Template DNA, 2μg; 5×PS Bufferr, 20μL; dNTP, 8μL; NopZ-R, 2μL; NopZ-F, 2μg; PrimeSTAR, 1.2μL; ddH2O, up to 100μL;
[0039] Reaction conditions (...
Embodiment 2
[0054] Embodiment 2. Construct the mutant of Rhizobium HH103
[0055] 1. Triparental hybridization experiment method: Streak the Escherichia coli with pJQ200SK-NopZ on the LB solid medium containing Km and Gent resistance; streak the wild-type rhizobia HH103 on the TY solid medium containing Rif resistance Middle; Escherichia coli carrying the Helper plasmid was streaked on LB solid medium containing Km resistance. Cultivate overnight until a single clone grows; culture the three bacterial clones in 7mL of the corresponding medium to OD 600 The value is about 0.65; each pipette 1mL into a new 1.5mL centrifuge tube, centrifuge at 12 000rpm for 30s at room temperature, discard the supernatant, and resuspend repeatedly with 1mL anti-TY (adjust OD600 to 0.6); Take 200 μL of the resuspended HH103 bacterial solution, 100 μL each of pJQ200SK-NopZ Escherichia coli and Escherichia coli with Helper plasmid into a new 1.5mL centrifuge tube, centrifuge at 11995rpm for 30s, discard the su...
Embodiment 3
[0064] Example 3. Construction of anaplerotic strain pFAJ1702-NopZ and identification of nodulation ability
[0065] 1. Design primers: start at about 500 bp before the NopZ start codon and end at NopZ as the amplified fragment. Use DNAMAN to analyze enzymes that cannot cut HindⅢ, BamHI, and design primers. pFAJ1702-NopZ-F (CCCAAGCTTCGTGCGATGCGCGAGATA, SEQ ID NO: 11), pFAJ1702-NopZ-R (CGCGGATCCTTACCGGAACTCGTTGCG, SEQ ID NO: 12).
[0066] The steps are: (1) Use pFAJ1702-NopZ(F / R) to amplify the whole genome of Sinorhizobium HH103, after purifying the product, carry out double enzyme digestion of the vector and NopZ target product for 3-5 hours, perform product purification after enzyme digestion, and ligate for 16 hours After that, it was transferred into Escherichia coli, and the bacterial solution was sequenced after PCR verification;
[0067] (2) An anaplerotic strain of NopZ was obtained by three-parent hybridization, and the anaplerotic strain was named HH103ΩNopZpFAJ1702-...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


