Application of MEP1B gene in preparation of product for detecting or regulating endometrial development
An endometrial and gene technology is applied in the application field of MEP1B gene in the preparation and detection of endometrial development products. planting effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Preparation and identification of total exosomes from porcine uterine cavity fluid in 4 different periods
[0045] 1. Preparation of total exosomes from porcine uterine cavity fluid in 4 different periods
[0046](1) The uteruses of large white sows (provided by Wenshi Sanhe Slaughterhouse, 3 repetitions at each time, 12 heads in total) of 9 days in estrus, 9 days of pregnancy, 12 days of pregnancy and 15 days of pregnancy were taken;
[0047] (2) Cut a small opening on one side of the uterus, insert one end of the blasting tube into the small opening and inject air with a syringe to fix the position of the blasting tube in the uterine cavity, and use the other end of the blasting tube to collect PBS in a 50ml centrifuge tube rinse solution;
[0048] (3) Inject the syringe containing PBS into the uterine cavity, clamp the upstream part of the injection port, slowly inject PBS into the uterine cavity, and gently squeeze the PBS flushing liquid to the direction...
Embodiment 2
[0075] Example 2 Construction of overexpression vector pDouble Ex-EGFP-MEP1B
[0076] (1) Digest pDouble Ex-EGFP(+) eukaryotic expression vector (purchased from Changsha Yingrun Biotechnology Co., Ltd.) with EcoRI and XhoI. The specific reaction system (50 μl) is: EcoRI 2.5 μl, XhoI 2.5 μl , pDouble Ex-EGFP(+) 2.5μl, FD Buffer 10μl, ddH 2 O 32.5 μl; the reaction procedure is: enzyme digestion at 37°C for 2 hours; after enzyme digestion, use agarose gel electrophoresis with a mass volume ratio of 1.5% to detect the enzyme digestion result and recover the target fragment;
[0077] (2) Extract the cDNA of the endometrium of the large white sow (provided by Wenshi Sanhe Slaughterhouse) on the 12th day of pregnancy, use the cDNA as a template, and use specific upstream and downstream primers (MEP1B) containing EcoRI and XhoI restriction sites respectively -F: CCGGAATTC ATGGATTCTTGGTATCTGCCTTCGT; MEP1B-R: CCGCTCGAG TCACAGTGCATATTGATTTTCCAGAGT) for PCR amplification, amplificati...
Embodiment 3
[0087] Design and synthesis of embodiment 3MEP1B gene siRNA
[0088] 1. Search the CDS region sequence of the porcine MEP1B gene (NCBI Reference Sequence: XM_003127883.5) on the website of the National Institute of Biology NCBI (http: / / www.ncbi.nlm.nih.gov / ), and use BLOCK-iTRNAiDesigner software (http: / / rnaidesigner.thermofisher.com / rnaiexpress / sort.do), designed 3 pairs of siRNA for different target sites of pig MEP1B gene, and designed negative control siRNA-NC (sequence shown in Table 1), the sequence was provided by Suzhou Synthesized by Gemma Gene Co., Ltd.
[0089] Table 1 Sequence of siRNA of porcine MEP1B gene
[0090]
[0091]
[0092] 2. Cell transfection of three pairs of siRNA and NC interference fragments
[0093] (1) Separation method of pig endometrial epithelial cells: pick fresh large white sow uterus (not pregnant), cut the uterus in ultra-clean table, and take endometrium; the endometrial tissue that will be taken is rinsed once with PBS, cut into ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More