Method for isothermal amplification of nucleic acid target sequence

An isothermal amplification and nucleic acid target technology, which is applied in the field of thermal amplification of nucleic acid target sequences, can solve problems such as false positives, incorrect reaction, unreasonable product analysis, etc., and achieve the effect of ensuring specificity

Inactive Publication Date: 2021-10-08
SHANGHAI BIOGERM MEDICAL TECH CO LTD BEIJING BRANCH +1
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Using methods other than the fluorescence method can easily lead to false positives, and the patent labels the primers, so that the reaction cannot be carried out correctly. At the same time, the non-specific reaction of the labeled primers will bring false positive results
Due to factors such as too long reaction time and unreasonable product analysis, there is no product on the market at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for isothermal amplification of nucleic acid target sequence
  • Method for isothermal amplification of nucleic acid target sequence
  • Method for isothermal amplification of nucleic acid target sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] The detection of the plasmid that embodiment 1 carries human gene PSMB2

[0087] The primer probe sequence (5'-3') is as follows:

[0088] PSMB2-B (primer): CCCAGCACTTT

[0089] PSMB2-F (primer): TTCAGACTATTGAGTCTATTCTGACCAACAT

[0090] PSMB2-R (primer): GTCAGACTATTGAGTCTTCTCCCAGCTAAT

[0091] PSMB2-P (probe): ATGGTAGTAGAGACGGGGTTTTTACCAT

[0092] The reaction system (final concentration of each component) is as follows:

[0093] Tris-HCl pH8.0, 50mM

[0094] (NH4) 2 SO 4 , 20mM

[0095] MgCl 2 , 10mM

[0096] NaCl, 30mM

[0097] KCl, 10mM

[0098] dNTPs, 1mM

[0099] Betaine, 0.5M

[0100] PSMB2-B, 200mM

[0101] PSMB2-F, 300mM

[0102] PSMB2-R, 300mM

[0103] PSMB2-P, 300mM

[0104] Nt.BstNBI, 3U

[0105] Bst 2.0 warmstart, 4.8U

[0106] The reaction was carried out at 55 ° C, and the signal was collected every 10 s, and the instrument was LightCycler 480II. Detect plasmids 1E5, 1E4, 1E3, 1E2, 1E1 and no template control, the results are as follows...

Embodiment 2

[0107] Example 2 Mycoplasma pneumoniae clinical sample detection

[0108] The primer probe sequence (5'-3') is as follows:

[0109] Mp-B (primer): CTCTCCACTAA

[0110] Mp-F (primer): CATAGACTTATGAGTCTTCTATTCGCTTC

[0111] Mp-R (primer): GTTAGACTTTTGAGTCTTCTTGCTCTGGT

[0112] Mp-P (probe): CGCAGCTGGTTACGGGAATACTGCG

[0113] The reaction system (final concentration of each component) is as follows:

[0114] Tris-HCl pH8.0, 50mM

[0115] (NH4) 2 SO 4 , 20mM

[0116] MgCl 2 , 8mM

[0117] NaCl, 30mM

[0118] KCl, 10mM

[0119] dNTPs, 1mM

[0120] Betaine, 0.5M

[0121] Mp-B (primer), 200mM

[0122] Mp-F (primer), 400mM

[0123] Mp-R (primer), 400mM

[0124] Mp-P (probe), 300mM

[0125] Nt.BstNBI, 3U

[0126] Bst 2.0 warmstart, 4.8U

[0127] The reaction was carried out at 55 ° C, and the signal was collected every 10 s, and the instrument was LightCycler 480II. Detected 8 cases of lung branch samples, the results are as follows Figure 5 As shown, all 8 cases ...

Embodiment 3

[0129] Example 3 Influenza B virus (single-stranded RNA virus) clinical sample detection

[0130] The primer probe sequence (5'-3') is as follows:

[0131] FluB-B (primer): TGTTGCTAAACT

[0132] FluB-F (primer): CTACTGATGAGTCTTTTTAGTGGAGG A T

[0133] FluB-R (primer): CCTTCATTGAGTCTTTTGAAG A GTGA

[0134] FluB-P (probe): ACGGCCATCGGATCCTCAAGCCGT

[0135] Note:" A " Modified with LNA.

[0136] The reaction system (final concentration of each component) is as follows:

[0137] Tris-HCl pH8.0, 50mM

[0138] (NH4) 2 SO 4 , 20mM

[0139] MgCl 2 , 8mM

[0140] NaCl, 30mM

[0141] KCl, 10mM

[0142] dNTPs, 1mM

[0143] Betaine, 0.5M

[0144] FluB-B (primer), 200mM

[0145] FluB-F (primer), 400mM

[0146] FluB-R (primer), 400mM

[0147] FluB-P (probe), 300mM

[0148] Nt.BstNBI, 3U

[0149] Bst 3.0, 6U

[0150] The reaction was carried out at 55 ° C, and the signal was collected every 10 s, and the instrument was LightCycler 480II. Detect 8 clinical samples of i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for isothermal amplification of a nucleic acid target sequence. The method is suitable for the combined reaction of double-stranded DNA, single-stranded DNA and single-stranded RNA, including nickase and strand displacement enzyme, three primers and one probe are adopted during the detection of the double-stranded DNA and the single-stranded DNA, and three primers and one probe or two primers and one probe can be adopted during the detection of the single-stranded RNA. The probe is a molecular beacon, does not degrade in the amplification process, is only used for specifically binding with a target fragment, provides a fluorescence signal and guarantees the specificity of the reaction. According to the invention, a result is judged in real time by adopting the beacon probe which is not overlapped with the primer in the binding area on the target sequence, and beacon probe binding target sequence has very high specificity; meanwhile, a tube is not opened after the reaction, so that false positive is further avoided; the reaction is carried out at a constant temperature, the consumed time is short, the detection can be completed within 8 minutes, and the POCT detection requirements are met better.

Description

technical field [0001] The invention belongs to the field of nucleic acid detection, and in particular relates to a method for isothermally amplifying a nucleic acid target sequence. Background technique [0002] Polymerase chain reaction (Polymerase chain reaction, PCR) is currently the most widely used nucleic acid amplification detection technology (Nucleic Acid Amplification Test, NAAT). The classic reaction of this technology includes three steps of denaturation, renaturation, and extension. It is a process that requires rapid temperature cycling. It requires a specific thermal cycler for high-precision temperature control and consumes a lot of power. At the same time, the reaction time is long, which cannot meet the requirements of point-of-care detection (POCT). Although there are products that complete the reaction in 15-30 minutes in recent years, these products rely on extremely complicated industrial designs, and the cost is too high. [0003] In order to solve ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6844
CPCC12Q1/6844C12Q2563/107C12Q2531/119Y02A50/30
Inventor杨孙孝朱兆奎昃白尘
OwnerSHANGHAI BIOGERM MEDICAL TECH CO LTD BEIJING BRANCH