Construction method of mitochondrial genome sequencing library based on high-throughput sequencing and amplification primer
A technology for amplification primers and construction methods, applied in the field of mitochondrial genome sequencing library construction methods and amplification primers, can solve the problems of expensive, cumbersome operations, and increased costs, so as to improve integrity and accuracy and ensure effectiveness , Simplify the effect of personnel operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0028] The technical solutions of the present invention will be described below in conjunction with specific embodiments, but the present invention is not limited to the following examples.
[0029] Take 4 samples, verify the sample inventions, and implement the specific steps of the implementation process are as follows:
[0030] 1, MTDNA template extraction and preservation
[0031] The collected peripheral venous blood is extracted by a conventional whole blood DNA extraction process.
[0032] 2, primer pair design
[0033] The primary pyrotal amplification primer primers 1 and primers were designed using PrimerPremier 5, and the primer sequence is shown in Table 1.
[0034] Table 1. MTDNA amplification primers
[0035] Numbering Primer sequence SEQ ID NO.1 MT1-F GGTAAAGGTCGTTTATCCCCC SEQ ID NO.2 MT1-R Tatgcctcttcacg SEQ ID NO.3 MT2-F CgatctCGaccccccc SEQ ID NO.4 MT2-R Aggggcgtttggtgggg
[0036] 3. Use two pairs of amplification primers, w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


